Human PNLIPRP3 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PNLIPRP3
Locus ID	119548
Kit Components	GA114690G1, PNLIPRP3 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AACTCGGAACATCTTATAGC GA114690G2, PNLIPRP3 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: GAAAGTGCCTAATCCTGGTT GA114690G3, PNLIPRP3 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: TGTGCCTTACATCTTATGAT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001011709
Synonyms	OTTHUMP00000020563; pancreatic lipase-related protein 3

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.