Human RBM20 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	RBM20
Locus ID	282996
Kit Components	GA116976G1, RBM20 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: TCAAGTAGTTGCTAGGTCTC GA116976G2, RBM20 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: ATTTTCCTCCCGCAACCACG GA116976G3, RBM20 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: ACGCTTTTCTCTACTTCCCG 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_001134363
Summary	This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.