Mouse Il4 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	Il4
Locus ID	16189
Kit Components	GA202145G1, Il4 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCCCAGAATAACTGACAATC GA202145G2, Il4 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGGAAAATGAGTTTACAT GA202145G3, Il4 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: CCAGGAGAAAAAAGAGAAAC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_021283, NR_027491
Synonyms	BSF-1; Il-4
Summary	Participates in at least several B-cell activation processes as well as of other cell types (PubMed:3083412). It is a costimulator of DNA-synthesis. It induces the expression of class II MHC molecules on resting B-cells (PubMed:3498301). It enhances both secretion and cell surface expression of IgE and IgG1 (PubMed:3498301). It also regulates the expression of the low affinity Fc receptor for IgE (CD23) on both lymphocytes and monocytes. Positively regulates IL31RA expression in macrophages (PubMed:25847241). Stimulates autophagy in dendritic cells by interfering with mTORC1 signaling and through the induction of RUFY4 (PubMed:26416964).[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.