CNOT7 Human Gene Knockout Kit (CRISPR)

CAT#: KN209293

CNOT7 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


CNOT7 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


CNOT7 (Myc-DDK-tagged)-Human CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1
    • 10 ug

CNY 2,400.00
CNY 3,990.00

Specifications

Product Data
Format 2 gRNA vectors, 1 GFP-puro donor, 1 scramble control
Donor DNA GFP-puro
Symbol CNOT7
Locus ID 29883
Kit Components

KN209293G1, CNOT7 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TAAAACGCTTCATATAAAGG

KN209293G2, CNOT7 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AGTCTTGAATTCAACCCTTT

KN209293-D, donor DNA containing left and right homologous arms and GFP-puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_013354, NM_054026, NM_001322087, NM_001322088, NM_001322089, NM_001322090, NM_001322091, NM_001322092, NM_001322093, NM_001322094, NM_001322095, NM_001322096, NM_001322097, NM_001322098, NM_001322099, NM_001322100
Synonyms CAF1; Caf1a; hCAF-1
Summary The protein encoded by this gene binds to an anti-proliferative protein, B-cell translocation protein 1, which negatively regulates cell proliferation. Binding of the two proteins, which is driven by phosphorylation of the anti-proliferative protein, causes signaling events in cell division that lead to changes in cell proliferation associated with cell-cell contact. The encoded protein downregulates the innate immune response and therefore provides a therapeutic target for enhancing its antimicrobial activity against foreign agents. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and X. [provided by RefSeq, Apr 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...