Leptin Receptor (LEPR) Human Gene Knockout Kit (CRISPR)

CAT#: KN218456LP

LEPR - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12,260.00


货期*
6周

规格
    • 1 kit

Product images

经常一起买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Goat Polyclonal Antibody against Leptin Receptor
    • 100 ug

CNY 5,371.00


LEPR (Myc-DDK-tagged)-Human leptin receptor (LEPR), transcript variant 1
    • 10 ug

CNY 8,112.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol Leptin Receptor
Locus ID 3953
Kit Components

KN218456G1, Leptin Receptor gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: TGTGTGGTTTTGTTACATTG

KN218456G2, Leptin Receptor gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: CAAAATCTCTACCATGTTTA

KN218456LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_001003679, NM_001003680, NM_001198687, NM_001198688, NM_001198689, NM_002303
Synonyms CD295; LEP-R; LEPRD; OB-R; OBR
Summary The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...