Dll1 Mouse Gene Knockout Kit (CRISPR)

CAT#: KN504620

Dll1 - KN2.0, Mouse gene knockout kit via CRISPR, non-homology mediated.




 KN2.0 knockout kit validation

  See Other Versions

CNY 8,680.00

CNY 12,260.00


货期*
2周

规格
    • 1 kit

Product images

经常一起买 (2)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3,710.00


Dll1 (Myc-DDK-tagged) - Mouse delta-like 1 (Drosophila) (Dll1)
    • 10 ug

CNY 7,928.00

Specifications

Product Data
Format 2 gRNA vectors, 1 linear donor
Donor DNA EF1a-GFP-P2A-Puro
Symbol Dll1
Locus ID 13388
Kit Components

KN504620G1, Dll1 gRNA vector 1 in pCas-Guide CRISPR vector

KN504620G2, Dll1 gRNA vector 2 in pCas-Guide CRISPR vector

KN504620D, Linear donor DNA containing LoxP-EF1A-tGFP-P2A-Puro-LoxP

LoxP-EF1A-tGFP-P2A-Puro-LoxP (2739 bp)

The sequence below is cassette sequence only. The linear donor DNA also contains proprietary target sequence.
ATAACTTCGTATAATGTATGCTATACGAAGTTAT CGTGAGGCTCCGGTGCCCGTCAGTGGGCAGAGCGCACATCGCCCACAGTCCCCGAGAAGTTGGGGGGAGGGGTCGGCAATTGAACCGGTGCCTAGAGAAGGTGGCGCGGGGTAAACTGGGAAAGTGATGTCGTGTACTGGCTCCGCCTTTTTCCCGAGGGTGGGGGAGAACCGTATATAAGTGCAGTAGTCGCCGTGAACGTTCTTTTTCGCAACGGGTTTGCCGCCAGAACACAGGTAAGTGCCGTGTGTGGTTCCCGCGGGCCTGGCCTCTTTACGGGTTATGGCCCTTGCGTGCCTTGAATTACTTCCACCTGGCTGCAGTACGTGATTCTTGATCCCGAGCTTCGGGTTGGAAGTGGGTGGGAGAGTTCGAGGCCTTGCGCTTAAGGAGCCCCTTCGCCTCGTGCTTGAGTTGAGGCCTGGCCTGGGCGCTGGGGCCGCCGCGTGCGAATCTGGTGGCACCTTCGCGCCTGTCTCGCTGCTTTCGATAAGTCTCTAGCCATTTAAAATTTTTGATGACCTGCTGCGACGCTTTTTTTCTGGCAAGATAGTCTTGTAAATGCGGGCCAAGATCTGCACACTGGTATTTCGGTTTTTGGGGCCGCGGGCGGCGACGGGGCCCGTGCGTCCCAGCGCACATGTTCGGCGAGGCGGGGCCTGCGAGCGCGGCCACCGAGAATCGGACGGGGGTAGTCTCAAGCTGGCCGGCCTGCTCTGGTGCCTGGCCTCGCGCCGCCGTGTATCGCCCCGCCCTGGGCGGCAAGGCTGGCCCGGTCGGCACCAGTTGCGTGAGCGGAAAGATGGCCGCTTCCCGGCCCTGCTGCAGGGAGCTCAAAATGGAGGACGCGGCGCTCGGGAGAGCGGGCGGGTGAGTCACCCACACAAAGGAAAAGGGCCTTTCCGTCCTCAGCCGTCGCTTCATGTGACTCCACGGAGTACCGGGCGCCGTCCAGGCACCTCGATTAGTTCTCGAGCTTTTGGAGTACGTCGTCTTTAGGTTGGGGGGAGGGGTTTTATGCGATGGAGTTTCCCCACACTGAGTGGGTGGAGACTGAAGTTAGGCCAGCTTGGCACTTGATGTAATTCTCCTTGGAATTTGCCCTTTTTGAGTTTGGATCTTGGTTCATTCTCAAGCCTCAGACAGTGGTTCAAAGTTTTTTTCTTCCATTTCAGGTGTCGTGA ATGGAGAGCGACGAGAGCGGCCTGCCCGCCATGGAGATCGAGTGCCGCATCACCGGCACCCTGAACGGCGTGGAGTTCGAGCTGGTGGGCGGCGGAGAGGGCACCCCCGAGCAGGGCCGCATGACCAACAAGATGAAGAGCACCAAAGGCGCCCTGACCTTCAGCCCCTACCTGCTGAGCCACGTGATGGGCTACGGCTTCTACCACTTCGGCACCTACCCCAGCGGCTACGAGAACCCCTTCCTGCACGCCATCAACAACGGCGGCTACACCAACACCCGCATCGAGAAGTACGAGGACGGCGGCGTGCTGCACGTGAGCTTCAGCTACCGCTACGAGGCCGGCCGCGTGATCGGCGACTTCAAGGTGATGGGCACCGGCTTCCCCGAGGACAGCGTGATCTTCACCGACAAGATCATCCGCAGCAACGCCACCGTGGAGCACCTGCACCCCATGGGCGATAACGATCTGGATGGCAGCTTCACCCGCACCTTCAGCCTGCGCGACGGCGGCTACTACAGCTCCGTGGTGGACAGCCACATGCACTTCAAGAGCGCCATCCACCCCAGCATCCTGCAGAACGGGGGCCCCATGTTCGCCTTCCGCCGCGTGGAGGAGGATCACAGCAACACCGAGCTGGGCATCGTGGAGTACCAGCACGCCTTCAAGACCCCGGATGCAGATGCCGGTGAAGAAAGA GGAAGCGGAGCTACTAACTTCAGCCTGCTGAAGCAGGCTGGAGACGTGGAGGAGAACCCTGGACCT ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGCCGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGCAAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCGGTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAGCGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGTTCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTGGAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCGGCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCGGTGCCTGA AACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTA ATAACTTCGTATAATGTATGCTATACGAAGTTAT

Disclaimer These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPR technology. The system has been functionally validated for knocking-in the cassette downstream the native promoter. The efficiency of the knock-out varies due to the nature of the biology and the complexity of the experimental process.
Reference Data
RefSeq NM_007865
Synonyms Delta1
Summary Transmembrane ligand protein of NOTCH1, NOTCH2 and NOTCH3 receptors that binds the extracellular domain (ECD) of Notch receptor in a cis and trans fashion manner (PubMed:21985982, PubMed:10958687). Following transinteraction, ligand cells produce mechanical force that depends of a clathrin-mediated endocytosis, requiring ligand ubiquitination, EPN1 interaction, and actin polymerisation; these events promote Notch receptor extracellular domain (NECD) transendocytosis and triggers Notch signaling through induction of cleavage, hyperphosphorylation, and nuclear accumulation of the intracellular domain of Notch receptors (NICD) (PubMed:10958687, PubMed:18676613). Is required for embryonic development and maintenance of adult stem cells in many different tissues and immune systeme; the DLL1-induced Notch signaling is mediated through an intercellular communication that regulates cell lineage, cell specification, cell patterning and morphogenesis through effects on differentiation and proliferation (PubMed:17194759, PubMed:19562077, PubMed:18997111, PubMed:23695674, PubMed:16495313, PubMed:21238454, PubMed:22282195, PubMed:7671806, PubMed:17960184, PubMed:22529374, PubMed:19389377, PubMed:23699523, PubMed:19144989, PubMed:23688253, PubMed:23806616, PubMed:26114479, PubMed:22940113, PubMed:25220152, PubMed:20081190, PubMed:21572390, PubMed:22096075). Plays a role in brain development at different level, namely by regulating neuronal differentiation of neural precursor cells via cell-cell interaction, most likely through the lateral inhibitory system in an endogenous level dependent-manner (PubMed:7671806, PubMed:18997111). During neocortex development, Dll1-Notch signaling transmission is mediated by dynamic interactions between intermediate neurogenic progenitors and radial glia; the cell-cell interactions are mediated via dynamic and transient elongation processes, likely to reactivate/maintain Notch activity in neighboring progenitors, and coordinate progenitor cell division and differentiation across radial and zonal boundaries (PubMed:23699523). During cerebellar development, regulates Bergmann glial monolayer formation and its morphological maturation through a Notch signaling pathway (PubMed:23688253). At the retina and spinal cord level, regulates neurogenesis by preventing the premature differentiation of neural progenitors and also by maintaining progenitors in spinal cord through Notch signaling pathway (PubMed:19389377, PubMed:26114479). Also controls neurogenesis of the neural tube in a progenitor domain-specific fashion along the dorsoventral axis (PubMed:20081190). Maintains quiescence of neural stem cells and plays a role as a fate determinant that segregates asymmetrically to one daughter cell during neural stem cells mitosis, resulting in neuronal differentiation in Dll1-inheriting cell (PubMed:23695674). Plays a role in immune systeme development, namely the development of all T-cells and marginal zone (MZ) B cells (PubMed:15146182, PubMed:19217325). Blocks the differentiation of progenitor cells into the B-cell lineage while promoting the emergence of a population of cells with the characteristics of a T-cell/NK-cell precursor (By similarity). Upon MMP14 cleavage, negatively regulates Notch signaling in haematopoietic progenitor cells to specifically maintain normal B-cell development in bone marrow (PubMed:21572390). Also plays a role during muscle development. During early development, inhibits myoblasts differentiation from the medial dermomyotomal lip and later regulates progenitor cell differentiation (PubMed:17194759). Directly modulates cell adhesion and basal lamina formation in satellite cells through Notch signaling. Maintains myogenic progenitors pool by suppressing differentiation through down-regulation of MYOD1 and is required for satellite cell homing and PAX7 expression (PubMed:22940113). During craniofacial and trunk myogenesis suppresses differentiation of cranial mesoderm-derived and somite-derived muscle via MYOD1 regulation but in cranial mes
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...