Twist (TWIST1) Human qPCR Primer Pair (NM_000474)
CNY 1,140.00
Cited in 4 publications. |
Product images
CNY 3,600.00
CNY 3,705.00
CNY 2,710.00
Specifications
Product Data | |
Gene ID | 7291 |
Forward Sequence | GCCAGGTACATCGACTTCCTCT |
Reverse Sequence | TCCATCCTCCAGACCGAGAAGG |
Synonyms | ACS3; bHLHa38; BPES2; BPES3; CRS; CRS1; CSO; SCS; SWCOS; TWIST |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[TWIST1]
|
Epigenetic Role of Histone Lysine Methyltransferase and Demethylase on the Expression of Transcription Factors Associated with the Epithelial-to-Mesenchymal Transition of Lung Adenocarcinoma Metastasis to the Brain
,Lee, YM;Kim, SH;Kim, MS;Kim, DC;Lee, EH;Lee, JS;Lee, SH;Kim, YZ;,
Cancers
,PubMed ID 33291558
[TWIST1]
|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[TWIST1]
|
Knockdown of TWIST1 enhances arsenic trioxide- and ionizing radiation-induced cell death in lung cancer cells by promoting mitochondrial dysfunction
,Seo, SK;Kim, JH;Choi, HN;Choe, TB;Hong, SI;Yi, JY;Hwang, SG;Lee, HG;Lee, YH;Park, IC;,
Biochem. Biophys. Res. Commun.
,PubMed ID 24845567
[TWIST1]
|
Documents
FAQs |
Resources
基因表达相关资源 |