GAPDH Human qPCR Primer Pair (NM_002046)
CNY 1,140.00
货期*
5周
规格
Cited in 66 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
A ready-to-use mix for SYBR Green qPCR, containing ROX reference and suitable for all qPCR instruments without adjusting the concentration of ROX.
CNY 2,710.00
Mouse monoclonal anti-GAPDH antibody, clone OTI2D9 (formerly 2D9), loading control
CNY 600.00
Specifications
Product Data | |
Gene ID | 2597 |
Forward Sequence | GTCTCCTCTGACTTCAACAGCG |
Reverse Sequence | ACCACCCTGTTGCTGTAGCCAA |
Synonyms | G3PD; GAPD; HEL-S-162eP |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (66)
The use of this Gene Expression has been cited in the following citations: |
---|
Extracellular vesicles carrying HIV-1 Nef induce long-term hyperreactivity of myeloid cells
,null,
Cell reports
,PubMed ID 36417867
[GAPDH]
|
HIV integration in the human brain is linked to microglial activation and 3D genome remodeling.
,null,
Molecular cell
,PubMed ID 36525955
[GAPDH]
|
C9orf16 represents the aberrant genetic programs and drives the progression of PDAC.
,null,
BMC cancer
,PubMed ID 36307773
[GAPDH]
|
Lidocaine inhibited migration of NSCLCA549 cells via the CXCR4 regulation
,null,
Cancer Biomarkers
,PubMed ID 34334384
[GAPDH]
|
A Multi-Organ-on-Chip Approach to Investigate How Oral Exposure to Metals Can Cause Systemic Toxicity Leading to Langerhans Cell Activation in Skin
,null,
Frontiers in Toxicology
,PubMed ID 35295125
[GAPDH]
|
Kynurenine Monooxygenase Expression and Activity in Human Astrocytomas
,null,
Cells
,PubMed ID 34440798
[GAPDH]
|
The Anti-Non-Small Cell Lung Cancer Cell Activity by a mTOR Kinase Inhibitor PQR620
,Zha, JH;Xia, YC;Ye, CL;Hu, Z;Zhang, Q;Xiao, H;Yu, BT;Xu, WH;Xu, GQ;,
Frontiers in oncology
,PubMed ID 34178653
[GAPDH]
|
Up-Regulation of the Long Noncoding RNA X-Inactive-Specific Transcript and the Imbalance Sex/Ratio of Pulmonary Arterial Hypertension
,Qin, S;Predescu, D;Carman, B;Patel, P;Chen, J;Kim, M;Lahm, T;Geraci, M;Predescu, S;,
The American journal of pathology
,PubMed ID 33836164
[GAPDH]
|
MicroRNA-15a Carried by Mesenchymal Stem Cell-Derived Extracellular Vesicles Inhibits the Immune Evasion of Colorectal Cancer Cells by Regulating the KDM4B/HOXC4/PD-L1 Axis
,null,
Frontiers in Cell and Developmental Biology
,PubMed ID 33732698
[GAPDH]
|
miR-708 Negatively Regulates TNFα/IL-1β Signaling by Suppressing NF-κB and Arachidonic Acid Pathways
,Monteleone, NJ;Lutz, CS;,
Mediators of inflammation
,PubMed ID 33776573
[GAPDH]
|
Authentic and Ectopically Expressed MRGPRX2 Elicit Similar Mechanisms to Stimulate Degranulation of Mast Cells
,Lazki-Hagenbach, P;Ali, H;Sagi-Eisenberg, R;,
Cells
,PubMed ID 33673037
[GAPDH]
|
A novel cause of DKC1 ‐related bone marrow failure: Partial deletion of the 3′ untranslated region
,Arthur, J;Pickett, H;Barbaro, P;Kilo, T;Vasireddy, R;Beilharz, T;Powell, D;Hackett, E;Bennetts, B;Curtin, J;Jones, K;Christodoulou, J;Reddel, R;Teo, J;Bryan, T;,
eJHaem
[GAPDH]
|
ATPIF1 maintains normal mitochondrial structure which is impaired by CCM3 deficiency in endothelial cells
,Wang, K;Chen, H;Zhou, Z;Zhang, H;Zhou, HJ;Min, W;,
Cell & bioscience
,PubMed ID 33422124
[GAPDH]
|
Activation of NLRP3 by uropathogenic Escherichia coli is associated with IL-1β release and regulation of antimicrobial properties in human neutrophils
,Demirel, I;Persson, A;Brauner, A;Särndahl, E;Kruse, R;Persson, K;,
Scientific reports
,PubMed ID 33318544
[GAPDH]
|
miR-708-5p Enhances Erlotinib/paclitaxel Efficacy and Overcomes Chemoresistance in Lung Cancer Cells
,Monteleone, N;Lutz, C;,
Oncotarget.
,PubMed ID 33473256
[GAPDH]
|
Epigenetic Role of Histone Lysine Methyltransferase and Demethylase on the Expression of Transcription Factors Associated with the Epithelial-to-Mesenchymal Transition of Lung Adenocarcinoma Metastasis to the Brain
,Lee, YM;Kim, SH;Kim, MS;Kim, DC;Lee, EH;Lee, JS;Lee, SH;Kim, YZ;,
Cancers
,PubMed ID 33291558
[GAPDH]
|
Vorinostat-loaded titanium oxide nanoparticles (anatase) induce G2/M cell cycle arrest in breast cancer cells via PALB2 upregulation
,Abdel-Ghany, S;Raslan, S;Tombuloglu, H;Shamseddin, A;Cevik, E;Said, O;Madyan, E;Senel, M;Bozkurt, A;Rehman, S;Sabit, H;,
3 Biotech
,PubMed ID 32904337
[GAPDH]
|
Long Noncoding RNA KCNQ1OT1 Confers Gliomas Resistance to Temozolomide and Enhances Cell Growth by Retrieving PIM1 From miR-761
,Wang, W;Han, S;Gao, W;Feng, Y;Li, K;Wu, D;,
Cell. Mol. Neurobiol.
,PubMed ID 32897512
[GAPDH]
|
FoxF1 protects rats from paraquat-evoked lung injury following HDAC2 inhibition via the microRNA-342/KLF5/IκB/NF-κB p65 axis
,Zheng, F;Liu, T;Zhu, J;Xie, Y;Wu, L;Lin, Z;,
Exp. Cell Res.
,PubMed ID 32758486
[GAPDH]
|
Impaired AKT signaling and lung tumorigenesis by PIERCE1 ablation in KRAS-mutant non-small cell lung cancer
,Roh, JI;Lee, J;Sung, YH;Oh, J;Hyeon, DY;Kim, Y;Lee, S;Devkota, S;Kim, HJ;Park, B;Nam, T;Song, Y;Kim, Y;Hwang, D;Lee, HW;,
Oncogene
,PubMed ID 32728173
[GAPDH]
|
Differential influence of Streptococcus mitis on host response to metals in reconstructed human skin and oral mucosa
,Shang, L;Deng, D;Roffel, S;Gibbs, S;,
Contact Derm.
,PubMed ID 32677222
[GAPDH]
|
Titanium salts tested in reconstructed human skin with integrated MUTZ-3 derived Langerhans cells show an irritant rather than a sensitizing potential
,Rodrigues Neves, CT;Spiekstra, SW;de Graaf, NPJ;Rustemeyer, T;Feilzer, AJ;Kleverlaan, CJ;Gibbs, S;,
Contact Derm.
,PubMed ID 32677096
[GAPDH]
|
Non-viral Gene Delivery of HIF-1α Promotes Angiogenesis in Human Adipose-Derived Stem Cells
,Est-Witte, S;Farris, A;Tzeng, S;Hutton, D;Gong, D;Calabresi, K;Grayson, W;Green, J;,
Acta Biomaterialia
,PubMed ID 32623098
[GAPDH]
|
miR-708-5p targets oncogenic prostaglandin E2 production to suppress a pro-tumorigenic phenotype in lung cancer cells
,Monteleone, NJ;Lutz, CS;,
Oncotarget
,PubMed ID 32655834
[GAPDH]
|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[GAPDH]
|
Galectin-1 Overexpression Activates the FAK/PI3K/AKT/mTOR Pathway and Is Correlated with Upper Urinary Urothelial Carcinoma Progression and Survival
,Su, YL;Luo, HL;Huang, CC;Liu, TT;Huang, EY;Sung, MT;Lin, JJ;Chiang, PH;Chen, YT;Kang, CH;Cheng, YT;,
Cells
,PubMed ID 32225123
[GAPDH]
|
Rapid generation of purified human RPE from pluripotent stem cells using 2D cultures and lipoprotein uptake-based sorting
,Michelet, F;Balasankar, A;Teo, N;Stanton, LW;Singhal, S;,
Stem Cell Res Ther
,PubMed ID 32014053
[GAPDH]
|
Long noncoding RNA UCA1 promotes autophagy by targeting miR-96-5p in acute myeloid leukemia
,Li, JJ;Chen, XF;Wang, M;Zhang, PP;Zhang, F;Zhang, JJ;,
Clin. Exp. Pharmacol. Physiol.
,PubMed ID 31953866
[GAPDH]
|
Ninjurin2 overexpression promotes glioma cell growth
,Zhou, LN;Li, P;Cai, S;Li, G;Liu, F;,
Aging (Albany NY) 2019
,PubMed ID 31794427
[GAPDH]
|
CysLT1 receptor antagonists Pranlukast and Zafirlukast inhibit LRRC8-mediated volume regulated anion channels independently of the receptor
,Figueroa, EE;Kramer, M;Strange, K;Denton, JS;,
Am. J. Physiol., Cell Physiol.
,PubMed ID 31390227
[GAPDH]
|
microRNA-7 inhibition protects human osteoblasts from dexamethasone via activation of epidermal growth factor receptor signaling
,Fan, JB;Liu, W;Zhu, XH;Cui, SY;Cui, ZM;Zhao, JN;,
Mol. Cell. Biochem.
,PubMed ID 31313024
[GAPDH]
|
MicroRNA Let-7f-1-3p attenuates smoke-induced apoptosis in bronchial and alveolar epithelial cells in vitro by targeting FOXO1
,Han, Z;Zhu, Y;Cui, Z;Guo, P;Wei, A;Meng, Q;,
Eur. J. Pharmacol.
,PubMed ID 31301310
[GAPDH]
|
Long non-coding RNA LINC00641 suppresses non-small-cell lung cancer by sponging miR-424-5p to upregulate PLSCR4
,Li, Y;Zhao, L;Zhao, P;Liu, Z;,
Cancer Biomark
,PubMed ID 31322545
[GAPDH]
|
Endothelial senescence is induced by phosphorylation and nuclear export of telomeric repeat binding factor 2-interacting protein
,Kotla, S;Vu, HT;Ko, KA;Wang, Y;Imanishi, M;Heo, KS;Fujii, Y;Thomas, TN;Gi, YJ;Mazhar, H;Paez-Mayorga, J;Shin, JH;Tao, Y;Giancursio, CJ;Medina, JL;Taunton, J;Lusis, AJ;Cooke, JP;Fujiwara, K;Le, NT;Abe, JI;,
JCI Insight
,PubMed ID 31045573
[GAPDH]
|
Methylation of SPARCL1 Is Associated with Oncologic Outcome of Advanced Upper Urinary Tract Urothelial Carcinoma
,Luo, HL;Chiang, PH;Huang, CC;Su, YL;Sung, MT;Tsai, EM;Lin, CS;Chiang, PH;,
Int J Mol Sci
,PubMed ID 30987093
[GAPDH]
|
Upregulation of CBP by PLY can cause permeability of blood-brain barrier to increase meningitis
,Chen, JQ;Li, NN;Wang, BW;Liu, XF;Liu, JL;Chang, Q;,
J. Biochem. Mol. Toxicol.
,PubMed ID 30980515
[GAPDH]
|
Identification of myeloid-derived suppressor cells that have an immunosuppressive function in NF2 patients
,Wang, Y;Li, P;Wang, B;Wang, S;Liu, P;,
J. Cancer Res. Clin. Oncol.
,PubMed ID 30603902
[GAPDH]
|
Overexpression of CCN1 in Het1A cells attenuates bile-induced esophageal metaplasia through suppressing non-canonical NFκB activation
,Dang, T;Meng, X;Modak, C;Wu, J;Chang, Z;Che, N;Narvaez, R;Chai, J;,
Cytokine
,PubMed ID 30685604
[GAPDH]
|
EGF ligand fused to truncated Pseudomonas aeruginosa exotoxin A specifically targets and inhibits EGFR‑positive cancer cells
,Hashimi, SM;Grant, B;Alqurashi, N;Alowaidi, F;Wei, MQ;,
Oncol. Rep.
,PubMed ID 30226622
[GAPDH]
|
ETV1 activates a rapid conduction transcriptional program in rodent and human cardiomyocytes
,Shekhar, A;Lin, X;Lin, B;Liu, FY;Zhang, J;Khodadadi-Jamayran, A;Tsirigos, A;Bu, L;Fishman, GI;Park, DS;,
Sci Rep
,PubMed ID 29967479
[GAPDH]
|
Methods to Study the Role of Progranulin in the Tumor Microenvironment
,Elkabets, M;Brook, S;,
Methods Mol. Biol.
,PubMed ID 29956276
[GAPDH]
|
Assessing stemness and proliferation properties of the newly established colon cancer 'stem' cell line, CSC480 and novel approaches to identify dormant cancer cells
,Alowaidi, F;Hashimi, SM;Alqurashi, N;Alhulais, R;Ivanovski, S;Bellette, B;Meedenyia, A;Lam, A;Wood, S;,
Oncol. Rep.
,PubMed ID 29693155
[GAPDH]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[GAPDH]
|
Dengue virus compartmentalization during antibody-enhanced infection
,Ong, EZ;Zhang, SL;Tan, HC;Gan, ES;Chan, KR;Ooi, EE;,
Sci Rep
,PubMed ID 28084461
[GAPDH]
|
Cyclophosphamide promotes breast cancer cell migration through CXCR4 and matrix metalloproteinases
,Hung, CM;Hsu, YC;Chen, TY;Chang, CC;Lee, MJ;,
Cell Biol. Int
,PubMed ID 28035725
[GAPDH]
|
Increased epidermal thickness and abnormal epidermal differentiation in keloid scars
,Limandjaja, GC;van den Broek, LJ;Waaijman, T;van Veen, HA;Everts, V;Monstrey, S;Scheper, RJ;Niessen, FB;Gibbs, S;,
Br. J. Dermatol.
,PubMed ID 27377288
[GAPDH]
|
Serum availability affects expression of common house-keeping genes in colon adenocarcinoma cell lines: implications for quantitative real-time PCR studies
,Krzystek-Korpacka, M;Hotowy, K;Czapinska, E;Podkowik, M;Bania, J;Gamian, A;Bednarz-Misa, I;,
Cytotechnology
,PubMed ID 27339468
[GAPDH]
|
PKC epsilon Promotes Synaptogenesis through Membrane Accumulation of the Postsynaptic Density Protein PSD-95
,Sen, A;Hongpaisan, J;Wang, D;Nelson, TJ;Alkon, DL;,
J. Biol. Chem.
,PubMed ID 27330081
[GAPDH]
|
Host glycosylation pathways and the unfolded protein response contribute to the infection by Francisella
,Barel, M;Harduin-Lepers, A;Portier, L;Slomianny, MC;Charbit, A;,
Cell. Microbiol.
,PubMed ID 27185209
[GAPDH]
|
Sulfotransferase-1A1-dependent bioactivation of aristolochic acid I and N-hydroxyaristolactam I in human cells
,Hashimoto, K;Zaitseva, IN;Bonala, R;Attaluri, S;Ozga, K;Iden, CR;Johnson, F;Moriya, M;Grollman, AP;Sidorenko, VS;,
Carcinogenesis
,PubMed ID 27207664
[GAPDH]
|
miR-146a Attenuates Inflammatory Pathways Mediated by TLR4/NF-κB and TNFα to Protect Primary Human Retinal Microvascular Endothelial Cells Grown in High Glucose
,null,
Mediators of Inflammation
,PubMed ID 26997759
[GAPDH]
|
MicroRNA-153 is a prognostic marker and inhibits cell migration and invasion by targeting SNAI1 in human pancreatic ductal adenocarcinoma
,Bai, Z;Sun, J;Wang, X;Wang, H;Pei, H;Zhang, Z;,
Oncol. Rep.
,PubMed ID 26062664
[GAPDH]
|
Anti-proliferative effects of ?-tocotrienol are associated with suppression of c-Myc expression in mammary tumour cells
,Parajuli, P;Tiwari, RV;Sylvester, PW;,
Cell Prolif.
,PubMed ID 26096843
[GAPDH]
|
In vivo delivery of transcription factors with multifunctional oligonucleotides
,Lee, K;Rafi, M;Wang, X;Aran, K;Feng, X;Lo Sterzo, C;Tang, R;Lingampalli, N;Kim, HJ;Murthy, N;,
Nat Mater
,PubMed ID 25915034
[GAPDH]
|
A Mechanistic Investigation of Fc? R Signaling During Antibody-enhanced Dengue Infection
,ONG ZIYING, E;,
Thesis
[GAPDH]
|
MicroRNA-520g induces epithelial-mesenchymal transition and promotes metastasis of hepatocellular carcinoma by targeting SMAD7
,Kan, H;Guo, W;Huang, Y;Liu, D;,
FEBS Lett.
,PubMed ID 25436421
[GAPDH]
|
Expression Stability of Common Housekeeping Genes Is Differently Affected by Bowel Inflammation and Cancer: Implications for Finding Suitable Normalizers for Inflammatory Bowel Disease Studies
,Krzystek-Korpacka, M;Diakowska, D;Bania, J;Gamian, A;,
Inflamm. Bowel Dis.
,PubMed ID 24859298
[GAPDH]
|
A cellular model of amyloid precursor protein processing and amyloid-Beta peptide production
,Macias, MP;Gonzales, AM;Siniard, AL;Walker, AW;Corneveaux, JJ;Huentelman, MJ;Sabbagh, MN;Decourt, B;,
J. Neurosci. Methods Dec 2013.
,PubMed ID 24333289
[GAPDH]
|
Differential gene expression in cholesteatoma by DNA chip analysis.
,null,
The Laryngoscope
,PubMed ID 23670528
[GAPDH]
|
NAC1, A POZ/BTB protein interacts with Parkin and may contribute to Parkinson's disease
,Korutla, L;Furlong, HA;Mackler, SA;,
Neuroscience
,PubMed ID 24231739
[GAPDH]
|
Human papillomavirus type 16 E7 oncoprotein inhibits the anaphase promoting complex/cyclosome activity by dysregulating EMI1 expression in mitosis
,Yu, Y;Munger, K;,
Virology. 2013 Nov;446(1-2):251-9. doi: 10.1016/j.virol.2013.08.013
,PubMed ID 24074588
[GAPDH]
|
Delivery of small interfering RNAs in human cervical cancer cells by polyethylenimine-functionalized carbon nanotubes
,null,
Nanoscale Research Letters
,PubMed ID 23742156
[GAPDH]
|
The Human Papillomavirus Type 8 E6 Protein Interferes with NOTCH Activation during Keratinocyte Differentiation
,Jordan M. Meyers, Jennifer M. Spangle, and Karl Munger,
J. Virol., Apr 2013; 87: 4762 - 4767.
,PubMed ID 23365452
[GAPDH]
|
Sulfated Polysaccharide, Curdlan Sulfate, Efficiently Prevents Entry/Fusion and Restricts Antibody-Dependent Enhancement of Dengue Virus Infection In Vitro: A Possible Candidate for Clinical Application
,null,
PLoS Neglected Tropical Diseases
,PubMed ID 23658845
[GAPDH]
|
Nitric Oxide–Producing Myeloid-Derived Suppressor Cells Inhibit Vascular E-Selectin Expression in Human Squamous Cell Carcinomas
,Ahmed E Gehad, Michael K Lichtman, Chrysalyne D Schmults, Jessica E Teague, Adam W Calarese, Ying Jiang, Rei Watanabe & Rachael A Clark,
Journal of Investigative Dermatology doi:10.1038/jid.2012.190
[GAPDH]
|
Dentin Sialophosphoprotein (DSPP) Gene-Silencing Inhibits Key Tumorigenic Activities in Human Oral Cancer Cell Line, OSC2
,null,
PLoS ONE
,PubMed ID 21103065
[GAPDH]
|
Documents
FAQs |
Resources
基因表达相关资源 |
Customer
Reviews
Loading...