p53 (TP53) Human qPCR Primer Pair (NM_000546)
CNY 1,140.00
Cited in 22 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
CNY 2,710.00
CNY 3,656.00
CNY 5,320.00
CNY 3,656.00
CNY 3,990.00
CNY 3,990.00
CNY 3,990.00
CNY 5,488.00
CNY 5,795.00
CNY 2,640.00
CNY 3,990.00
CNY 3,990.00
CNY 3,656.00
CNY 3,990.00
CNY 3,990.00
CNY 3,990.00
Specifications
Product Data | |
Gene ID | 7157 |
Forward Sequence | CCTCAGCATCTTATCCGAGTGG |
Reverse Sequence | TGGATGGTGGTACAGTCAGAGC |
Synonyms | BCC7; BMFS5; LFS1; P53; TRP53 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (22)
The use of this Gene Expression has been cited in the following citations: |
---|
Impaired AKT signaling and lung tumorigenesis by PIERCE1 ablation in KRAS-mutant non-small cell lung cancer
,Roh, JI;Lee, J;Sung, YH;Oh, J;Hyeon, DY;Kim, Y;Lee, S;Devkota, S;Kim, HJ;Park, B;Nam, T;Song, Y;Kim, Y;Hwang, D;Lee, HW;,
Oncogene
,PubMed ID 32728173
[TP53]
|
Mongolian Medicine RuXian-I Treatment of Estrogen-Induced Mammary Gland Hyperplasia in Rats Related to TCTP Regulating Apoptosis
,null,
Evidence-based Complementary and Alternative Medicine : eCAM
,PubMed ID 31015848
[TP53]
|
Arecoline N-oxide regulates oral squamous cell carcinoma development through NOTCH1 and FAT1 expressions
,Kuo, TM;Nithiyanantham, S;Lee, CP;Hsu, HT;Luo, SY;Lin, YZ;Yeh, KT;Ko, YC;,
J. Cell. Physiol.
,PubMed ID 30624777
[TP53]
|
Length and secondary structure of the 5â² non-coding regions of mouse p53 mRNA transcripts - mouse as a model organism for p53 gene expression studies
,null,
RNA Biology
,PubMed ID 30518296
[TP53]
|
Functional role of RRS1 in breast cancer cell proliferation. Functional role of RRS1 in breast cancer cell proliferation
,null,
Journal of Cellular and Molecular Medicine
,PubMed ID 30320499
[TP53]
|
Isolated Langerhans cell histiocytosis of the stomach: a case report and literature review
,null,
International Journal of Clinical and Experimental Pathology
,PubMed ID 31949684
[TP53]
|
PEPD is a pivotal regulator of p53 tumor suppressor
,null,
Nature Communications
,PubMed ID 29233996
[TP53]
|
The Tumor Suppressor, P53, Decreases the Metal Transporter, ZIP14
,null,
Nutrients
,PubMed ID 29292794
[TP53]
|
Musashi-2, a novel oncoprotein promoting cervical cancer cell growth and invasion, is negatively regulated by p53-induced miR-143 and miR-107 activation
,null,
Journal of Experimental & Clinical Cancer Research : CR
,PubMed ID 29073938
[TP53]
|
iASPP induces EMT and cisplatin resistance in human cervical cancer through miR-20a-FBXL5/BTG3 signaling
,null,
Journal of Experimental & Clinical Cancer Research : CR
,PubMed ID 28399926
[TP53]
|
mir-660-p53-mir-486 Network: A New Key Regulatory Pathway in Lung Tumorigenesis
,null,
International Journal of Molecular Sciences
,PubMed ID 28124991
[TP53]
|
Suppression of iASPP-dependent aggressiveness in cervical cancer through reversal of methylation silencing of microRNA-124
,null,
Scientific Reports
,PubMed ID 27765948
[TP53]
|
Synergy between histone deacetylase inhibitors and DNA-damaging agents is mediated by histone deacetylase 2 in colorectal cancer
,null,
Oncotarget
,PubMed ID 27283986
[TP53]
|
Intravenous leiomyomatosis with intracardiac extension depicted on computed tomography and magnetic resonance imaging scans: A report of two cases and a review of the literature
,null,
Oncology Letters
,PubMed ID 27313775
[TP53]
|
Mitochondrial p53 phosphorylation induces Bak-mediated and caspase-independent cell death
,null,
Oncotarget
,PubMed ID 25980443
[TP53]
|
NORE1A is a Ras senescence effector that controls the apoptotic/senescent balance of p53 via HIPK2
,null,
The Journal of Cell Biology
,PubMed ID 25778922
[TP53]
|
Cytosolic galectin-7 impairs p53 functions and induces chemoresistance in breast cancer cells
,null,
BMC Cancer
,PubMed ID 25367122
[TP53]
|
p53 suppresses stress-induced cellular senescence via regulation of autophagy under the deprivation of serum.
,null,
Molecular medicine reports
,PubMed ID 25369834
[TP53]
|
Expression of Galectin-7 Is Induced in Breast Cancer Cells by Mutant p53
,null,
PLoS ONE
,PubMed ID 23967302
[TP53]
|
Downregulation of SMG-1 in HPV-positive head and neck squamous cell carcinoma due to promoter hypermethylation correlates with improved survival
,null,
Clinical cancer research : an official journal of the American Association for Cancer Research
,PubMed ID 22247495
[TP53]
|
Discovery, In Vivo Activity, and Mechanism of Action of a Small-Molecule p53 Activator
,null,
Cancer Cell
,PubMed ID 18455128
[TP53]
|
Role of SCF Ubiquitin-Ligase and the COP9 Signalosome in the N Gene-Mediated Resistance Response to Tobacco mosaic virus
,null,
The Plant Cell
,PubMed ID 12119369
[TP53]
|
Documents
FAQs |
Resources
基因表达相关资源 |