IL1 beta (IL1B) Human qPCR Primer Pair (NM_000576)
CNY 1,140.00
Cited in 6 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 2,710.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 3553 |
Forward Sequence | CCACAGACCTTCCAGGAGAATG |
Reverse Sequence | GTGCAGTTCAGTGATCGTACAGG |
Synonyms | IL-1; IL1-BETA; IL1beta; IL1F2 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (6)
The use of this Gene Expression has been cited in the following citations: |
---|
Reactivated endogenous retroviruses promote protein aggregate spreading
,null,
Nature Communications
,PubMed ID 37596282
[IL1B]
|
Activation of NLRP3 by uropathogenic Escherichia coli is associated with IL-1β release and regulation of antimicrobial properties in human neutrophils
,Demirel, I;Persson, A;Brauner, A;Särndahl, E;Kruse, R;Persson, K;,
Scientific reports
,PubMed ID 33318544
[IL1B]
|
Titanium salts tested in reconstructed human skin with integrated MUTZ-3 derived Langerhans cells show an irritant rather than a sensitizing potential
,Rodrigues Neves, CT;Spiekstra, SW;de Graaf, NPJ;Rustemeyer, T;Feilzer, AJ;Kleverlaan, CJ;Gibbs, S;,
Contact Derm.
,PubMed ID 32677096
[IL1B]
|
Probing the response of human osteoblasts following exposure to sympathetic neuron-like PC-12 cells in a 3D co-culture model
,Erndt-Marino, J;Hahn, MS;,
J Biomed Mater Res A
,PubMed ID 27860234
[IL1B]
|
A 3D chondrocyte-macrophage co-culture system to probe inflammation in experimental osteoarthritis
,Samavedi, S;Diaz-Rodriguez, P;Erndt-Marino, JD;Hahn, M;,
Tissue Eng Part A
,PubMed ID 27736317
[IL1B]
|
Gene Signatures of 1,25-Dihydroxyvitamin D3 Exposure in Normal and Transformed Mammary Cells
,Simmons, KM;Beaudin, SG;Narvaez, CJ;Welsh, J;,
J. Cell. Biochem.
,PubMed ID 25736056
[IL1B]
|
Documents
FAQs |
Resources
基因表达相关资源 |