VEGFA Human qPCR Primer Pair (NM_001025366)
CNY 1,140.00
Cited in 5 publications. |
Product images
CNY 2,710.00
CNY 2,400.00
CNY 3,990.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 7422 |
Forward Sequence | TTGCCTTGCTGCTCTACCTCCA |
Reverse Sequence | GATGGCAGTAGCTGCGCTGATA |
Synonyms | MVCD1; VEGF; VPF |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (5)
The use of this Gene Expression has been cited in the following citations: |
---|
Non-viral Gene Delivery of HIF-1α Promotes Angiogenesis in Human Adipose-Derived Stem Cells
,Est-Witte, S;Farris, A;Tzeng, S;Hutton, D;Gong, D;Calabresi, K;Grayson, W;Green, J;,
Acta Biomaterialia
,PubMed ID 32623098
[VEGFA]
|
Distinct Local and Systemic Molecular Signatures in the Esophageal and Gastric Cancers: Possible Therapy Targets and Biomarkers for Gastric Cancer
,Bednarz-Misa, I;Fortuna, P;Diakowska, D;Jamrozik, N;Krzystek-Korpacka, M;,
Int J Mol Sci
,PubMed ID 32630408
[VEGFA]
|
Reconstructed human skin shows epidermal invagination towards integrated neopapillae indicating early hair follicle formation in vitro, et al. Reconstructed human skin shows epidermal invagination towards integrated neopapillae indicating early hair follicle formation in vitro
,null,
Journal of Tissue Engineering and Regenerative Medicine
,PubMed ID 32293116
[VEGFA]
|
Probing the response of human osteoblasts following exposure to sympathetic neuron-like PC-12 cells in a 3D co-culture model
,Erndt-Marino, J;Hahn, MS;,
J Biomed Mater Res A
,PubMed ID 27860234
[VEGFA]
|
Midkine is up-regulated in both cancerous and inflamed bowel, reflecting lymph node metastasis in colorectal cancer and clinical activity of ulcerative colitis
,Krzystek-Korpacka, M;Gorska, S;Diakowska, D;Kapturkiewicz, B;Podkowik, M;Gamian, A;Bednarz-Misa, I;,
Cytokine
,PubMed ID 27692729
[VEGFA]
|
Documents
FAQs |
Resources
基因表达相关资源 |