IL18 Human qPCR Primer Pair (NM_001562)
CNY 1,140.00
Cited in 3 publications. |
Product images
CNY 2,400.00
CNY 3,705.00
CNY 3,990.00
Specifications
Product Data | |
Gene ID | 3606 |
Forward Sequence | GATAGCCAGCCTAGAGGTATGG |
Reverse Sequence | CCTTGATGTTATCAGGAGGATTCA |
Synonyms | IGIF; IL-1g; IL-18; IL1F4 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Activation of NLRP3 by uropathogenic Escherichia coli is associated with IL-1β release and regulation of antimicrobial properties in human neutrophils
,Demirel, I;Persson, A;Brauner, A;Särndahl, E;Kruse, R;Persson, K;,
Scientific reports
,PubMed ID 33318544
[IL18]
|
ED SUM: The efficacy of chimeric antigen receptor (CAR)-T cells in solid tumor models is enhanced by IL23 engineering.
,null,
Nature biotechnology
,PubMed ID 32015548
[IL18]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[IL18]
|
Documents
FAQs |
Resources
基因表达相关资源 |