Ki67 (MKI67) Human qPCR Primer Pair (NM_002417)
CNY 1,140.00
Cited in 3 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 31,656.00
CNY 2,710.00
CNY 18,990.00
Specifications
Product Data | |
Gene ID | 4288 |
Forward Sequence | GAAAGAGTGGCAACCTGCCTTC |
Reverse Sequence | GCACCAAGTTTTACTACATCTGCC |
Synonyms | KIA; MIB-; MIB-1; PPP1R105 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Chronic Inflammation in Ulcerative Colitis Causes Long-Term Changes in Goblet Cell Function
,null,
Cellular and Molecular Gastroenterology and Hepatology
,PubMed ID 34418586
[MKI67]
|
Assessing stemness and proliferation properties of the newly established colon cancer 'stem' cell line, CSC480 and novel approaches to identify dormant cancer cells
,Alowaidi, F;Hashimi, SM;Alqurashi, N;Alhulais, R;Ivanovski, S;Bellette, B;Meedenyia, A;Lam, A;Wood, S;,
Oncol. Rep.
,PubMed ID 29693155
[MKI67]
|
Intravenous leiomyomatosis with intracardiac extension depicted on computed tomography and magnetic resonance imaging scans: A report of two cases and a review of the literature
,null,
Oncology Letters
,PubMed ID 27313775
[MKI67]
|
Documents
FAQs |
Resources
基因表达相关资源 |