Eotaxin (CCL11) Human qPCR Primer Pair (NM_002986)
CNY 1,140.00
Cited in 2 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,800.00
CNY 3,705.00
CNY 2,710.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 6356 |
Forward Sequence | GCTACAGGAGAATCACCAGTGG |
Reverse Sequence | GGAATCCTGCACCCACTTCTTC |
Synonyms | SCYA11 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (2)
The use of this Gene Expression has been cited in the following citations: |
---|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[CCL11]
|
Epithelial Cell-Derived IL-25, but Not Th17 Cell-Derived IL-17 or IL-17F, Is Crucial for Murine Asthma
,Maho Suzukawa, Hideaki Morita, Aya Nambu, Ken Arae, Eri Shimura, Akiko Shibui, Sachiko Yamaguchi, Keigo Suzukawa, Wakako Nakanishi, Keisuke Oboki, Naoki Kajiwara, Tatsukuni Ohno, Akina Ishii, Heinrich Körner, Daniel J. Cua, Hajime Suto, Takayuki Yoshimoto, Yoichiro Iwakura, Tatsuya Yamasoba, Ken Ohta, Katsuko Sudo, Hirohisa Saito, Ko Okumura, David H. Broide, Kenji Matsumoto, and Susumu Nakae,
J. Immunol., Oct 2012; 189: 3641 - 3652.
[CCL11]
|
Documents
FAQs |
Resources
基因表达相关资源 |