SOX2 Human qPCR Primer Pair (NM_003106)
CNY 1,140.00
Cited in 3 publications. |
Product images
CNY 3,600.00
CNY 4,465.00
CNY 2,710.00
Specifications
Product Data | |
Gene ID | 6657 |
Forward Sequence | GCTACAGCATGATGCAGGACCA |
Reverse Sequence | TCTGCGAGCTGGTCATGGAGTT |
Synonyms | ANOP3; MCOPS3 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
FOLFOX Therapy Induces Feedback Upregulation of CD44v6 through YB-1 to Maintain Stemness in Colon Initiating Cells
,null,
International Journal of Molecular Sciences
,PubMed ID 33451103
[SOX2]
|
Combined inhibition of Ref-1 and STAT3 leads to synergistic tumour inhibition in multiple cancers using 3D and in vivo tumour co-culture models
,Caston, RA;Shah, F;Starcher, CL;Wireman, R;Babb, O;Grimard, M;McGeown, J;Armstrong, L;Tong, Y;Pili, R;Rupert, J;Zimmers, TA;Elmi, AN;Pollok, KE;Motea, EA;Kelley, MR;Fishel, ML;,
Journal of cellular and molecular medicine
,PubMed ID 33274592
[SOX2]
|
Assessing stemness and proliferation properties of the newly established colon cancer 'stem' cell line, CSC480 and novel approaches to identify dormant cancer cells
,Alowaidi, F;Hashimi, SM;Alqurashi, N;Alhulais, R;Ivanovski, S;Bellette, B;Meedenyia, A;Lam, A;Wood, S;,
Oncol. Rep.
,PubMed ID 29693155
[SOX2]
|
Documents
FAQs |
Resources
基因表达相关资源 |