Vimentin (VIM) Human qPCR Primer Pair (NM_003380)
CNY 1,140.00
Cited in 5 publications. |
Product images
CNY 2,710.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 7431 |
Forward Sequence | AGGCAAAGCAGGAGTCCACTGA |
Reverse Sequence | ATCTGGCGTTCCAGGGACTCAT |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (5)
The use of this Gene Expression has been cited in the following citations: |
---|
MicroRNA-15a Carried by Mesenchymal Stem Cell-Derived Extracellular Vesicles Inhibits the Immune Evasion of Colorectal Cancer Cells by Regulating the KDM4B/HOXC4/PD-L1 Axis
,null,
Frontiers in Cell and Developmental Biology
,PubMed ID 33732698
[VIM]
|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[VIM]
|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[VIM]
|
Loss of GFAT1 promotes epithelial-to-mesenchymal transition and predicts unfavorable prognosis in gastric cancer
,Duan, F;Jia, D;Zhao, J;Wu, W;Min, L;Song, S;Wu, H;Wang, L;Wang, H;Ruan, Y;Gu, J;,
Oncotarget
,PubMed ID 27509259
[VIM]
|
Identification of proteins related to epigenetic regulation in the malignant transformation of aberrant karyotypic human embryonic stem cells by quantitative proteomics
,Sun, Y;Yang, Y;Zeng, S;Tan, Y;Lu, G;Lin, G;,
PLoS ONE, Jan 2014.
,PubMed ID 24465727
[VIM]
|
Documents
FAQs |
Resources
基因表达相关资源 |