EGFR Human qPCR Primer Pair (NM_005228)
CNY 1,140.00
Cited in 3 publications. |
Product images
CNY 4,680.00
CNY 7,315.00
CNY 2,710.00
CNY 12,640.00
CNY 8,264.00
CNY 3,656.00
CNY 3,990.00
Specifications
Product Data | |
Gene ID | 1956 |
Forward Sequence | AACACCCTGGTCTGGAAGTACG |
Reverse Sequence | TCGTTGGACAGCCTTCAAGACC |
Synonyms | ERBB; ERBB1; ERRP; HER1; mENA; NISBD2; PIG61 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
A Comprehensive Analysis of FUT8 Overexpressing Prostate Cancer Cells Reveals the Role of EGFR in Castration Resistance
,Höti, N;Lih, TS;Pan, J;Zhou, Y;Yang, G;Deng, A;Chen, L;Dong, M;Yang, RB;Tu, CF;Haffner, MC;Kay Li, Q;Zhang, H;,
Cancers (Basel) 2020
,PubMed ID 32085441
[EGFR]
|
microRNA-7 inhibition protects human osteoblasts from dexamethasone via activation of epidermal growth factor receptor signaling
,Fan, JB;Liu, W;Zhu, XH;Cui, SY;Cui, ZM;Zhao, JN;,
Mol. Cell. Biochem.
,PubMed ID 31313024
[EGFR]
|
EGF ligand fused to truncated Pseudomonas aeruginosa exotoxin A specifically targets and inhibits EGFR‑positive cancer cells
,Hashimi, SM;Grant, B;Alqurashi, N;Alowaidi, F;Wei, MQ;,
Oncol. Rep.
,PubMed ID 30226622
[EGFR]
|
Documents
FAQs |
Resources
基因表达相关资源 |