SNAIL (SNAI1) Human qPCR Primer Pair (NM_005985)
CNY 1,140.00
Cited in 4 publications. |
Product images
CNY 3,600.00
CNY 3,705.00
CNY 2,710.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 6615 |
Forward Sequence | TGCCCTCAAGATGCACATCCGA |
Reverse Sequence | GGGACAGGAGAAGGGCTTCTC |
Synonyms | dJ710H13.1; SLUGH2; SNA; SNAH; SNAIL; SNAIL1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[SNAI1]
|
Epigenetic Role of Histone Lysine Methyltransferase and Demethylase on the Expression of Transcription Factors Associated with the Epithelial-to-Mesenchymal Transition of Lung Adenocarcinoma Metastasis to the Brain
,Lee, YM;Kim, SH;Kim, MS;Kim, DC;Lee, EH;Lee, JS;Lee, SH;Kim, YZ;,
Cancers
,PubMed ID 33291558
[SNAI1]
|
Loss of GFAT1 promotes epithelial-to-mesenchymal transition and predicts unfavorable prognosis in gastric cancer
,Duan, F;Jia, D;Zhao, J;Wu, W;Min, L;Song, S;Wu, H;Wang, L;Wang, H;Ruan, Y;Gu, J;,
Oncotarget
,PubMed ID 27509259
[SNAI1]
|
MicroRNA-153 is a prognostic marker and inhibits cell migration and invasion by targeting SNAI1 in human pancreatic ductal adenocarcinoma
,Bai, Z;Sun, J;Wang, X;Wang, H;Pei, H;Zhang, Z;,
Oncol. Rep.
,PubMed ID 26062664
[SNAI1]
|
Documents
FAQs |
Resources
基因表达相关资源 |