Cyclophilin A (PPIA) Human qPCR Primer Pair (NM_021130)
CNY 1,140.00
Cited in 4 publications. |
Product images
CNY 1,800.00
CNY 3,705.00
CNY 2,710.00
CNY 3,990.00
Specifications
Product Data | |
Gene ID | 5478 |
Forward Sequence | GGCAAATGCTGGACCCAACACA |
Reverse Sequence | TGCTGGTCTTGCCATTCCTGGA |
Synonyms | CYPA; CYPH; HEL-S-69p |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (4)
The use of this Gene Expression has been cited in the following citations: |
---|
Transcriptional and Metabolomic Analysis of L-Arginine/Nitric Oxide Pathway in Inflammatory Bowel Disease and Its Association with Local Inflammatory and Angiogenic Response: Preliminary Findings
,Krzystek-Korpacka, M;Fleszar, MG;Bednarz-Misa, I;Lewandowski, Ł;Szczuka, I;Kempiński, R;Neubauer, K;,
Int J Mol Sci
,PubMed ID 32121248
[PPIA]
|
Midkine is up-regulated in both cancerous and inflamed bowel, reflecting lymph node metastasis in colorectal cancer and clinical activity of ulcerative colitis
,Krzystek-Korpacka, M;Gorska, S;Diakowska, D;Kapturkiewicz, B;Podkowik, M;Gamian, A;Bednarz-Misa, I;,
Cytokine
,PubMed ID 27692729
[PPIA]
|
Serum availability affects expression of common house-keeping genes in colon adenocarcinoma cell lines: implications for quantitative real-time PCR studies
,Krzystek-Korpacka, M;Hotowy, K;Czapinska, E;Podkowik, M;Bania, J;Gamian, A;Bednarz-Misa, I;,
Cytotechnology
,PubMed ID 27339468
[PPIA]
|
Expression Stability of Common Housekeeping Genes Is Differently Affected by Bowel Inflammation and Cancer: Implications for Finding Suitable Normalizers for Inflammatory Bowel Disease Studies
,Krzystek-Korpacka, M;Diakowska, D;Bania, J;Gamian, A;,
Inflamm. Bowel Dis.
,PubMed ID 24859301
[PPIA]
|
Documents
FAQs |
Resources
基因表达相关资源 |