Aurora A (AURKA) Human qPCR Primer Pair (NM_198433)
CNY 1,140.00
Cited in 2 publications. |
Product images
CNY 2,710.00
CNY 3,656.00
CNY 3,990.00
CNY 3,656.00
CNY 3,990.00
CNY 3,656.00
CNY 3,990.00
CNY 3,656.00
CNY 3,990.00
CNY 3,656.00
CNY 3,990.00
CNY 3,656.00
CNY 3,990.00
Specifications
Product Data | |
Gene ID | 6790 |
Forward Sequence | GCAACCAGTGTACCTCATCCTG |
Reverse Sequence | AAGTCTTCCAAAGCCCACTGCC |
Synonyms | AIK; ARK1; AURA; BTAK; PPP1R47; STK6; STK7; STK15 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (2)
The use of this Gene Expression has been cited in the following citations: |
---|
Exploring transcriptional regulators Ref-1 and STAT3 as therapeutic targets in malignant peripheral nerve sheath tumours
,Gampala, S;Shah, F;Zhang, C;Rhodes, SD;Babb, O;Grimard, M;Wireman, RS;Rad, E;Calver, B;Bai, RY;Staedtke, V;Hulsey, EL;Saadatzadeh, MR;Pollok, KE;Tong, Y;Smith, AE;Clapp, DW;Tee, AR;Kelley, MR;Fishel, ML;,
British journal of cancer
,PubMed ID 33658640
[AURKA]
|
Impaired AKT signaling and lung tumorigenesis by PIERCE1 ablation in KRAS-mutant non-small cell lung cancer
,Roh, JI;Lee, J;Sung, YH;Oh, J;Hyeon, DY;Kim, Y;Lee, S;Devkota, S;Kim, HJ;Park, B;Nam, T;Song, Y;Kim, Y;Hwang, D;Lee, HW;,
Oncogene
,PubMed ID 32728173
[AURKA]
|
Documents
FAQs |
Resources
基因表达相关资源 |