VCAM1 Human qPCR Primer Pair (NM_080682)
CNY 1,140.00
Cited in 3 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
CNY 8,120.00
CNY 2,710.00
CNY 5,700.00
CNY 7,936.00
Specifications
Product Data | |
Gene ID | 7412 |
Forward Sequence | GATTCTGTGCCCACAGTAAGGC |
Reverse Sequence | TGGTCACAGAGCCACCTTCTTG |
Synonyms | CD106; INCAM-100 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[VCAM1]
|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[VCAM1]
|
Endothelial senescence is induced by phosphorylation and nuclear export of telomeric repeat binding factor 2-interacting protein
,Kotla, S;Vu, HT;Ko, KA;Wang, Y;Imanishi, M;Heo, KS;Fujii, Y;Thomas, TN;Gi, YJ;Mazhar, H;Paez-Mayorga, J;Shin, JH;Tao, Y;Giancursio, CJ;Medina, JL;Taunton, J;Lusis, AJ;Cooke, JP;Fujiwara, K;Le, NT;Abe, JI;,
JCI Insight
,PubMed ID 31045573
[VCAM1]
|
Documents
FAQs |
Resources
基因表达相关资源 |