CXCR4 Human qPCR Primer Pair (NM_003467)
CNY 1,140.00
Cited in 3 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 5,488.00
CNY 2,710.00
CNY 5,488.00
Specifications
Product Data | |
Gene ID | 7852 |
Forward Sequence | CTCCTCTTTGTCATCACGCTTCC |
Reverse Sequence | GGATGAGGACACTGCTGTAGAG |
Synonyms | CD184; D2S201E; FB22; HM89; HSY3RR; LAP-3; LAP3; LCR1; LESTR; NPY3R; NPYR; NPYRL; NPYY3R; WHIM; WHIMS |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Lidocaine inhibited migration of NSCLCA549 cells via the CXCR4 regulation
,null,
Cancer Biomarkers
,PubMed ID 34334384
[CXCR4]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[CXCR4]
|
Cyclophosphamide promotes breast cancer cell migration through CXCR4 and matrix metalloproteinases
,Hung, CM;Hsu, YC;Chen, TY;Chang, CC;Lee, MJ;,
Cell Biol. Int
,PubMed ID 28035725
[CXCR4]
|
Documents
FAQs |
Resources
基因表达相关资源 |