Atp5c1 (NM_001112738) Mouse Untagged Clone

CAT#: MC207235

Atp5c1 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (Atp5c1), nuclear gene encoding mitochondrial protein, transcript variant 2, (10ug)



  "NM_001112738" in other vectors (3)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-Atp5c1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 1700094F02Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC207235 representing NM_001112738
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAACTCTGAAAGATATTACCAGGAGACTGAAGTCCATCAAAAACATCCAGAAAATTACCAAGTCTA
TGAAGATGGTGGCAGCTGCAAAGTATGCCCGGGCTGAGCGGGAGCTGAAGCCTGCCCGAGTGTATGGGAC
AGGTTCTTTGGCTCTGTATGAGAAGGCTGATATTAAGGCACCTGAGGACAAGAAGAAGCACCTCATTATT
GGTGTGTCCTCAGATAGAGGGCTTTGTGGTGCTATTCACTCCTCAGTGGCTAAACAGATGAAGAATGAAG
TGGCTGCCCTCACAGCAGCTGGGAAAGAAGTTATGATTGTTGGAGTTGGTGAAAAAATCAAGGGCATACT
TTATAGGACTCATTCTGATCAGTTTTTGGTGTCATTCAAAGATGTGGGACGGAAGCCTCCTACTTTTGGA
GATGCATCAGTCATTGCCCTTGAGTTGTTAAATTCTGGATATGAATTTGATGAAGGCTCTATCATTTTTA
ATCAGTTCAAGTCTGTTATCTCCTACAAGACAGAAGAGAAGCCCATCTTCTCTCTGAATACCATTGCGAC
TGCTGAGACCATGAGCATCTATGATGACATTGATGCTGATGTGCTGCAGAATTACCAGGAGTACAATCTG
GCCAACCTCATCTACTACTCCCTGAAGGAGTCCACCACCAGTGAGCAGAGTGCCAGGATGACCGCCATGG
ACAACGCCAGCAAGAACGCTTCTGATATGATTGACAAATTGACCTTGACTTTCAACCGCACCCGCCAGGC
TGTCATCACAAAGGAGTTGATTGAAATCATCTCTGGGGCTGCTGCTCTGGATTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001112738
Insert Size 825 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001112738.1, NP_001106209.1
RefSeq Size 1815 bp
RefSeq ORF 825 bp
Locus ID 11949
Gene Summary Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(1) domain and the central stalk which is part of the complex rotary element. The gamma subunit protrudes into the catalytic domain formed of alpha(3)beta(3). Rotation of the central stalk against the surrounding alpha(3)beta(3) subunits leads to hydrolysis of ATP in three separate catalytic sites on the beta subunits.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting protein (isoform b) has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...