Atp5c1 (NM_020615) Mouse Untagged Clone
CAT#: MC208164
Atp5c1 (untagged) - Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (Atp5c1), nuclear gene encoding mitochondrial protein, transcript variant 1, (10ug)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1700094F02Rik |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208164 representing NM_020615
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTTCTCGCGGGCGAGCGTTGTCGGGCTGTCGGCCTGCGCCGTGCAGCCGCAATGGATCCAAGTTCGAA ACATGGCAACTCTGAAAGATATTACCAGGAGACTGAAGTCCATCAAAAACATCCAGAAAATTACCAAGTC TATGAAGATGGTGGCAGCTGCAAAGTATGCCCGGGCTGAGCGGGAGCTGAAGCCTGCCCGAGTGTATGGG ACAGGTTCTTTGGCTCTGTATGAGAAGGCTGATATTAAGGCACCTGAGGACAAGAAGAAGCACCTCATTA TTGGTGTGTCCTCAGATAGAGGGCTTTGTGGTGCTATTCACTCCTCAGTGGCTAAACAGATGAAGAATGA AGTGGCTGCCCTCACAGCAGCTGGGAAAGAAGTTATGATTGTTGGAGTTGGTGAAAAAATCAAGGGCATA CTTTATAGGACTCATTCTGATCAGTTTTTGGTGTCATTCAAAGATGTGGGACGGAAGCCTCCTACTTTTG GAGATGCATCAGTCATTGCCCTTGAGTTGTTAAATTCTGGATATGAATTTGATGAAGGCTCTATCATTTT TAATCAGTTCAAGTCTGTTATCTCCTACAAGACAGAAGAGAAGCCCATCTTCTCTCTGAATACCATTGCG ACTGCTGAGACCATGAGCATCTATGATGACATTGATGCTGATGTGCTGCAGAATTACCAGGAGTACAATC TGGCCAACCTCATCTACTACTCCCTGAAGGAGTCCACCACCAGTGAGCAGAGTGCCAGGATGACCGCCAT GGACAACGCCAGCAAGAACGCTTCTGATATGATTGACAAATTGACCTTGACTTTCAACCGCACCCGCCAG GCTGTCATCACAAAGGAGTTGATTGAAATCATCTCTGGGGCTGCTGCTCTGGATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_020615 |
Insert Size | 897 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_020615.4, NP_065640.2 |
RefSeq Size | 1180 bp |
RefSeq ORF | 897 bp |
Locus ID | 11949 |
UniProt ID | Q91VR2 |
Gene Summary | Mitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(1) domain and the central stalk which is part of the complex rotary element. The gamma subunit protrudes into the catalytic domain formed of alpha(3)beta(3). Rotation of the central stalk against the surrounding alpha(3)beta(3) subunits leads to hydrolysis of ATP in three separate catalytic sites on the beta subunits.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the shorter transcript but encodes the longer protein (isoform a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG216752 | Atp5c1 (tGFP-tagged) - Mouse ATP synthase H+ transporting mitochondrial F1 complex gamma polypeptide 1 (Atp5c1) nuclear gene encoding mitochondrial protein transcript variant 1, (10ug) |
CNY 3,230.00 |
|
MR216752 | Atp5c1 (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (Atp5c1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,950.00 |
|
MR216752L3 | Lenti ORF clone of Atp5c1 (Myc-DDK-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (Atp5c1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,850.00 |
|
MR216752L4 | Lenti ORF clone of Atp5c1 (mGFP-tagged) - Mouse ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (Atp5c1), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,850.00 |