C5ar1 (NM_007577) Mouse Untagged Clone
CAT#: MC208206
C5ar1 (untagged) - Mouse complement component 5a receptor 1 (C5ar1), transcript variant 1, (10ug)
CNY 5,488.00
Cited in 2 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C5aR; C5r1; Cd88; D7Msu1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208206 representing NM_007577
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGACCCCATAGATAACAGCAGCTTTGAAATCAACTATGATCACTATGGAACCATGGATCCTAACATAC CTGCGGATGGCATTCACCTCCCGAAGCGGCAACCTGGGGATGTTGCAGCCCTTATCATCTACTCGGTGGT GTTCCTGGTGGGAGTACCCGGGAATGCCCTGGTGGTGTGGGTGACAGCCTTCGAGGCCAGACGGGCCGTC AACGCCATCTGGTTTCTGAATCTGGCGGTGGCCGACCTCCTCTCGTGCTTGGCACTGCCTGTCCTGTTCA CGACCGTTTTAAATCATAACTACTGGTACTTTGATGCCACCGCCTGTATAGTCCTGCCCTCGCTCATCCT GCTCAACATGTACGCCAGTATCCTGCTGCTGGCTACCATTAGTGCCGACCGTTTCCTGCTGGTGTTCAAG CCCATCTGGTGTCAGAAGGTCCGCGGGACTGGCCTGGCATGGATGGCCTGTGGAGTGGCCTGGGTCTTAG CATTGCTCCTCACCATTCCATCCTTCGTGTACCGGGAGGCATATAAGGACTTCTACTCAGAGCACACTGT ATGTGGTATTAACTATGGTGGGGGTAGCTTCCCCAAAGAGAAGGCTGTGGCCATCCTGCGGCTGATGGTG GGTTTTGTGTTGCCTCTGCTCACTCTAAACATCTGCTACACCTTCCTCCTGCTCCGGACCTGGAGTCGCA AGGCCACGCGCTCCACCAAGACGCTCAAAGTGGTGATGGCTGTGGTCATCTGTTTCTTTATCTTCTGGCT GCCCTATCAGGTGACCGGGGTGATGATAGCGTGGCTGCCCCCGTCCTCGCCCACCTTGAAGAGGGTGGAG AAGCTGAACTCCCTGTGCGTGTCCCTGGCCTACATCAACTGCTGTGTTAACCCTATCATCTACGTCATGG CTGGCCAGGGTTTCCATGGACGACTCCTAAGGTCTCTCCCCAGCATCATACGAAACGCTCTCTCTGAGGA TTCAGTGGGCAGGGATAGCAAGACTTTCACTCCGTCCACGACGGACACCTCAACCCGGAAGAGTCAGGCG GTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_007577 |
Insert Size | 1056 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC125641, AAI25642 |
RefSeq Size | 1267 bp |
RefSeq ORF | 1056 bp |
Locus ID | 12273 |
UniProt ID | P30993 |
Gene Summary | Receptor for the chemotactic and inflammatory peptide anaphylatoxin C5a. The ligand interacts with at least two sites on the receptor: a high-affinity site on the extracellular N-terminus, and a second site in the transmembrane region which activates downstream signaling events. Receptor activation stimulates chemotaxis, granule enzyme release, intracellular calcium release and superoxide anion production.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) and variant 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
CD177-mediated nanoparticle targeting of human and mouse neutrophils
,Miettinen, HM;Gripentrog, JM;Lord, CI;Nagy, JO;,
PLoS ONE
,PubMed ID 29990379
[C5AR1]
|
C5aR is frequently expressed in metastatic renal cell carcinoma and plays a crucial role in cell invasion via the ERK and PI3 kinase pathways
,Maeda, Y;Kawano, Y;Wada, Y;Yatsuda, J;Motoshima, T;Murakami, Y;Kikuchi, K;Imamura, T;Eto, M;,
Oncol. Rep.
,PubMed ID 25682807
[C5ar1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225064 | C5ar1 (tGFP-tagged) - Mouse complement component 5a receptor 1 (C5ar1) transcript variant 1, (10ug) |
CNY 7,088.00 |
|
MR225064 | C5ar1 (Myc-DDK-tagged) - Mouse complement component 5a receptor 1 (C5ar1), transcript variant 1 |
CNY 5,488.00 |
|
MR225064L3 | Lenti ORF clone of C5ar1 (Myc-DDK-tagged) - Mouse complement component 5a receptor 1 (C5ar1), transcript variant 1 |
CNY 5,230.00 |
|
MR225064L4 | Lenti ORF clone of C5ar1 (mGFP-tagged) - Mouse complement component 5a receptor 1 (C5ar1), transcript variant 1 |
CNY 7,888.00 |