United States
Germany
Japan
United Kingdom
China
Pdcd1 (NM_008798) Mouse Untagged Clone
CAT＃: MC209155
PD-1 / PDCD1 (untagged) - Mouse programmed cell death 1 (PD-1 / PDCD1), (10ug)
CNY 3,600.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Synonyms | Ly101; PD-1; Pdc1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>MC209155 representing NM_008798
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGGTCCGGCAGGTACCCTGGTCATTCACTTGGGCTGTGCTGCAGTTGAGCTGGCAATCAGGGTGGC TTCTAGAGGTCCCCAATGGGCCCTGGAGGTCCCTCACCTTCTACCCAGCCTGGCTCACAGTGTCAGAGGG AGCAAATGCCACCTTCACCTGCAGCTTGTCCAACTGGTCGGAGGATCTTATGCTGAACTGGAACCGCCTG AGTCCCAGCAACCAGACTGAAAAACAGGCCGCCTTCTGTAATGGTTTGAGCCAACCCGTCCAGGATGCCC GCTTCCAGATCATACAGCTGCCCAACAGGCATGACTTCCACATGAACATCCTTGACACACGGCGCAATGA CAGTGGCATCTACCTCTGTGGGGCCATCTCCCTGCACCCCAAGGCAAAAATCGAGGAGAGCCCTGGAGCA GAGCTCGTGGTAACAGAGAGAATCCTGGAGACCTCAACAAGATATCCCAGCCCCTCGCCCAAACCAGAAG GCCGGTTTCAAGGCATGGTCATTGGTATCATGAGTGCCCTAGTGGGTATCCCTGTATTGCTGCTGCTGGC CTGGGCCCTAGCTGTCTTCTGCTCAACAAGTATGTCAGAGGCCAGAGGAGCTGGAAGCAAGGACGACACT CTGAAGGAGGAGCCTTCAGCAGCACCTGTCCCTAGTGTGGCCTATGAGGAGCTGGACTTCCAGGGACGAG AGAAGACACCAGAGCTCCCTACCGCCTGTGTGCACACAGAATATGCCACCATTGTCTTCACTGAAGGGCT GGGTGCCTCGGCCATGGGACGTAGGGGCTCAGCTGATGGCCTGCAGGGTCCTCGGCCTCCAAGACATGAG GATGGACATTGTTCTTGGCCTCTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_008798 |
| Insert Size | 867 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC120602, AAI20603 |
| RefSeq Size | 1344 bp |
| RefSeq ORF | 867 bp |
| Locus ID | 18566 |
| UniProt ID | Q02242 |
| Gene Summary | Inhibitory receptor on antigen activated T-cells that plays a critical role in induction and maintenance of immune tolerance to self (PubMed:10485649, PubMed:11698646, PubMed:11209085, PubMed:21300912). Delivers inhibitory signals upon binding to ligands, such as CD274/PDCD1L1 and CD273/PDCD1LG2 (PubMed:11015443, PubMed:11224527, PubMed:22641383, PubMed:18287011, PubMed:18641123). Following T-cell receptor (TCR) engagement, PDCD1 associates with CD3-TCR in the immunological synapse and directly inhibits T-cell activation (PubMed:22641383). Suppresses T-cell activation through the recruitment of PTPN11/SHP-2: following ligand-binding, PDCD1 is phosphorylated within the ITSM motif, leading to the recruitment of the protein tyrosine phosphatase PTPN11/SHP-2 that mediates dephosphorylation of key TCR proximal signaling molecules, such as ZAP70, PRKCQ/PKCtheta and CD247/CD3zeta (PubMed:11698646, PubMed:22641383). The PDCD1-mediated inhibitory pathway is exploited by tumors to attenuate anti-tumor immunity and facilitate tumor survival (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
PD-1 independent of PD-L1 ligation promotes glioblastoma growth through the NFκB pathway
,null,
Science Advances
,PubMed ID 34739319
[Pdcd1]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG227347 | PD-1 / PDCD1 (tGFP-tagged) - Mouse programmed cell death 1 (PD-1 / PDCD1) |
CNY 5,200.00 |
|
| MR227347 | PD-1 / PDCD1 (Myc-DDK-tagged) - Mouse programmed cell death 1 (PD-1 / PDCD1) |
CNY 3,600.00 |
|
| MR227347L1 | Lenti ORF clone of Pdcd1 (Myc-DDK-tagged) - Mouse programmed cell death 1 (Pdcd1) |
CNY 6,000.00 |
|
| MR227347L2 | Lenti ORF clone of Pdcd1 (mGFP-tagged) - Mouse programmed cell death 1 (Pdcd1) |
CNY 6,000.00 |
|
| MR227347L3 | Lenti ORF clone of Pdcd1 (Myc-DDK-tagged) - Mouse programmed cell death 1 (Pdcd1) |
CNY 5,890.00 |
|
| MR227347L4 | Lenti ORF clone of Pdcd1 (mGFP-tagged) - Mouse programmed cell death 1 (Pdcd1) |
CNY 6,000.00 |
