Ptcra (NM_011195) Mouse Untagged Clone

CAT#: MC209251

Ptcra (untagged) - Mouse pre T-cell antigen receptor alpha (Ptcra), (10ug)



  "NM_011195" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms gp33; pT-alpha; pT-alpha-TCR; pTa; pTalpha; pT[a]
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC209251 representing NM_011195
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCTTCTCCACGAGTGGGCCATGGCTAGGACATGGCTGCTGCTGCTTCTGGGCGTCAGGTGTCAGGCTC
TACCATCAGGCATCGCTGGCACCCCCTTTCCGTCTCTGGCTCCACCCATCACACTGCTGGTAGATGGAAG
GCAGCACATGCTGGTGGTTTGCCTGGTCCTCGATGCGGCACCCCCTGGCCTTGACAACCCTGTCTGGTTC
TCAGCTGGCAATGGCAGTGCCCTAGACGCCTTCACCTATGGGCCCTCTCTGGCACCGGACGGCACCTGGA
CTAGCCTGGCCCAGCTCTCCTTGCCTTCTGAAGAGCTGGAAGCCTGGGAGCCCTTGGTCTGTCACACCAG
GCCTGGGGCTGGGGGACAGAACCGGAGCACACACCCCCTCCAGCTGTCAGGGGAATCTTCGACAGCCAGG
AGCTGCTTTCCGGAGCCTCTCGGGGGGACACAGCGGCAGGTACTGTGGCTGAGCCTACTGCGCCTGCTCC
TCTTCAAACTGCTTCTGCTCGATGTGCTCCTGACCTGCAGCCACCTCCGCCTCCATGTGCTGGCGGGCCA
GCACCTCCAGCCACCACCCTCACGCAAGTCCCTGCCTCCCACCCACAGAATTTGGACATAG


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_011195
Insert Size 621 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_011195.2, NP_035325.1
RefSeq Size 1283 bp
RefSeq ORF 621 bp
Locus ID 19208
UniProt ID P0C6B2
Gene Summary The pre-T-cell receptor complex (composed of PTCRA, TCRB and the CD3 complex) regulates early T-cell development. Isoform 1 acts to retain most TCRB intracellularly, while isoform 2 permits higher levels of cell surface TCRB expression and facilitates signaling from the CD3-TCRB complex.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...