Il1f6 (NM_019450) Mouse Untagged Clone
CAT#: MC209979
Il1f6 (untagged) - Mouse interleukin 1 family, member 6 (Il1f6), (10ug)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Fil1; IL-1H1; Il1f9; IL1RP2; Il36a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC209979 representing NM_019450
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAATAAGGAGAAAGAACTAAGAGCAGCATCACCTTCGCTTAGACATGTTCAGGATCTTAGTAGTCGTG TGTGGATCCTGCAGAACAATATCCTCACTGCAGTCCCAAGGAAAGAGCAAACAGTTCCAGTCACTATTAC CTTGCTCCCATGCCAATATCTGGACACTCTTGAGACGAACAGGGGGGATCCCACGTACATGGGAGTGCAA AGGCCGATGAGCTGCCTGTTCTGCACAAAGGATGGGGAGCAGCCTGTGCTACAGCTTGGGGAAGGGAACA TAATGGAAATGTACAACAAAAAGGAACCTGTAAAAGCCTCTCTCTTCTATCACAAGAAGAGTGGTACAAC CTCTACATTTGAGTCTGCAGCCTTCCCTGGTTGGTTCATCGCTGTCTGCTCTAAAGGGAGCTGCCCACTC ATTCTGACCCAAGAACTGGGGGAAATCTTCATCACTGACTTCGAGATGATTGTGGTACATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_019450 |
Insert Size | 483 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_019450.3, NP_062323.1 |
RefSeq Size | 883 bp |
RefSeq ORF | 483 bp |
Locus ID | 54448 |
UniProt ID | Q9JLA2 |
Gene Summary | Cytokine that binds to and signals through the IL1RL2/IL-36R receptor which in turn activates NF-kappa-B and MAPK signaling pathways in target cells linked to a pro-inflammatory response. Part of the IL-36 signaling system that is thought to be present in epithelial barriers and to take part in local inflammatory response; similar to the IL-1 system with which it shares the coreceptor IL1RAP. Seems to be involved in skin inflammatory response by acting on keratinocytes, dendritic cells and indirectly on T-cells to drive tissue infiltration, cell maturation and cell proliferation. Induces the production of proinflammatory cytokines, including IL-12, Il-1 beta, IL-6, TNF-alpha and IL-23 in bone marrow-derived dendritic cells (BMDCs). Involved in dendritic cell maturation by stimulating the surface expression of CD80, CD86 and MHC class II. Induces the production of IFN-gamma, IL-4 and IL-17 by cultured CD4(+) T-cells and splenocytes. May play a role in proinflammatory effects in the lung: induces the expression of CXCL1 and CXCL2 in the lung, and the expression of TNF-alpha, IL-36c, IL-1A, IL-1B, CXCL1 and CXCL2 in isolated splenic CD11c(+) alveolar macrophages. May be involved in T-cell maturation by stimulating the surface expression of CD40 and modestly CD80 and CD86 in splenic CD11c(+) cells. May be involved in CD4(+) T-cell proliferation. Induces NF-kappa B activation in macrophages.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225118 | Il1f6 (tGFP-tagged) - Mouse interleukin 1 family member 6 (Il1f6), (10ug) |
CNY 2,850.00 |
|
MR225118 | Il1f6 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 6 (Il1f6) |
CNY 1,200.00 |
|
MR225118L3 | Lenti ORF clone of Il1f6 (Myc-DDK-tagged) - Mouse interleukin 1 family, member 6 (Il1f6) |
CNY 4,750.00 |
|
MR225118L4 | Lenti ORF clone of Il1f6 (mGFP-tagged) - Mouse interleukin 1 family, member 6 (Il1f6) |
CNY 4,750.00 |