Klhl15 (NM_153165) Mouse Untagged Clone

CAT#: MC213030

Klhl15 (untagged) - Mouse kelch-like 15 (Drosophila) (Klhl15), transcript variant 4, (10ug)



  "NM_153165" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 6330500C13Rik
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC213030 representing NM_153165
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCAGGGGACGTGGAAGGATTCTGTTCCTCCATCCATGACACCAGTGTCTCTGCTGGGTTCAGAGCAC
TGTATGAGGAGGGATTGCTTCTCGATGTCACTCTGGTTATTGAAGACCATCAGTTCCAGGCCCATAAAGC
TCTCTTGGCCACCCAGAGTGATTACTTCAGAATTATGTTCACAGCAGACATGAGGGAACGAGATCAGGAC
AAAATTCATTTGAAAGGTCTAACAGCTACTGGTTTCAGCCACGTTCTTCAGTTTATGTATTATGGAACTA
TAGAACTAAGTATGAACACTGTACATGAAATCCTTCAGGCAGCAATGTATGTTCAGCTTATAGAAGTGGT
GAAATTCTGCTGCTCCTTTCTCTTAGCCAAAATCTGCTTAGAAAATTGTGCGGAAATTATGAGACTGTTA
GATGATTTCGGTGTTAACATCGAGGGAGTCAGGGAGAAGCTGGATGCCTTCCTGCTAGACAACTTCGTGC
CACTAATGTCCAGGCCTGACTTTTTGTCTTATCTGAGCTTCGAGAAGCTCATGTCTTATTTGGATAATGA
CCATCTGAGCAGGTTTCCAGAAATTGAGCTGTACGAGGCTGTGCAGTCTTGGCTGCGACATGATAGACGA
CGGTGGAGACACACAGATACCATCATTCAGAACATCAGGTTTTGTCTGATGACTCCATCCAGCGTCTTTG
AGAAGACATCGTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_153165
Insert Size 714 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_153165.2, NP_694805.1
RefSeq Size 3188 bp
RefSeq ORF 714 bp
Locus ID 236904
UniProt ID A2AAX3
Gene Summary Substrate-specific adapter for CUL3 E3 ubiquitin-protein ligase complex. Acts as an adapter for CUL3 to target the serine/threonine-protein phosphatase 2A (PP2A) subunit PPP2R5B for ubiquitination and subsequent proteasomal degradation, thus promoting exchange with other regulatory subunits and regulating PP2A holoenzyme composition. Acts as an adapter for CUL3 to target the DNA-end resection factor RBBP8/CtIP for ubiquitination and subsequent proteasomal degradation. Through the regulation of RBBP8/CtIP protein turnover, plays a key role in DNA damage response, favoring DNA double-strand repair through error-prone non-homologous end joining (NHEJ) over error-free, RBBP8-mediated homologous recombination (HR).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...