Kcna1 (NM_010595) Mouse Untagged Clone
CAT#: MC216958
Kcna1 (untagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, member 1 (Kcna1), (10ug)
CNY 6,460.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI840627; Kca1-1; Kv1.1; MBK1; mceph; Mk-1; Shak |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC216958 representing NM_010595
Red=Cloning site Blue=ORF Orange=Stop codon TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGACGGTGATGTCGGGGGAGAATGCGGACGAGGCTTCGACCGCTCCAGGTCACCCCCAGGATGGCAGCT ACCCGAGGCAGGCGGACCACGACGACCACGAATGCTGCGAGCGCGTAGTAATCAACATCTCCGGGCTGCG CTTCGAAACGCAGCTCAAGACTCTGGCACAGTTCCCCAACACGCTGCTGGGCAACCCGAAGAAACGCATG CGCTACTTTGACCCCCTGAGGAACGAGTACTTCTTTGACCGCAACCGGCCCAGCTTCGATGCCATCCTTT ATTACTACCAGTCCGGGGGCCGCCTGCGCAGGCCGGTCAACGTGCCCCTGGACATGTTCTCCGAGGAGAT TAAATTTTACGAGTTGGGCGAGGAAGCCATGGAGAAGTTCCGGGAAGATGAGGGCTTCATCAAGGAAGAG GAGCGCCCCCTACCCGAGAAGGAGTACCAGCGCCAGGTGTGGCTGCTCTTTGAGTATCCGGAGAGCTCAG GACCTGCCCGGGTTATTGCCATTGTGTCGGTCATGGTCATCCTCATCTCCATAGTCATCTTTTGCCTGGA GACTCTCCCTGAGCTGAAGGACGACAAGGACTTCACGGGCACCATCCACCGCATCGACAACACCACAGTC ATCTATACTTCCAACATCTTCACAGACCCTTTCTTCATTGTGGAAACCTTGTGTATCATCTGGTTCTCTT TTGAGCTGGTGGTGCGCTTCTTCGCCTGCCCCAGCAAGACAGACTTCTTTAAGAACATCATGAACTTCAT CGACATTGTGGCCATCATCCCTTATTTCATTACCCTGGGCACGGAGATAGCTGAGCAGGAGGGAAATCAG AAGGGCGAGCAGGCCACTTCCCTGGCCATCCTCAGGGTCATCCGCTTGGTAAGGGTGTTCAGAATCTTCA AACTCTCCCGCCACTCCAAGGGCCTTCAGATCCTGGGCCAGACCCTCAAAGCTAGTATGAGGGAGTTAGG GCTGCTCATCTTTTTCCTCTTCATTGGGGTCATACTGTTTTCTAGCGCAGTGTACTTTGCGGAGGCGGAA GAAGCTGAGTCGCACTTCTCCAGTATCCCCGATGCTTTCTGGTGGGCGGTGGTGTCCATGACCACTGTGG GATACGGTGACATGTACCCTGTGACAATTGGAGGCAAGATCGTGGGCTCCTTGTGTGCCATCGCTGGTGT GCTGACAATTGCCCTGCCCGTACCTGTCATTGTGTCCAATTTCAACTATTTCTACCACCGAGAAACTGAG GGGGAAGAGCAGGCTCAGTTGCTCCATGTTAGTTCTCCTAACTTAGCCTCTGACAGTGACCTCAGCCGCC GCAGCTCCTCTACTATCAGCAAGTCTGAGTACATGGAGATCGAAGAGGATATGAACAATAGCATAGCCCA TTACAGACAGGCTAATATCAGAACTGGTAACTGCACCACAGCTGATCAAAACTGCGTTAATAAGAGCAAG CTCCTGACCGATGTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_010595 |
Insert Size | 1488 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_010595.3, NP_034725.3 |
RefSeq Size | 8970 bp |
RefSeq ORF | 1488 bp |
Locus ID | 16485 |
UniProt ID | P16388 |
Gene Summary | Voltage-gated potassium channel that mediates transmembrane potassium transport in excitable membranes, primarily in the brain and the central nervous system, but also in the kidney. Contributes to the regulation of the membrane potential and nerve signaling, and prevents neuronal hyperexcitability (PubMed:9736643, PubMed:9581771 PubMed:10191303, PubMed:12611922, PubMed:21966978, PubMed:22158511, PubMed:23473320). Forms tetrameric potassium-selective channels through which potassium ions pass in accordance with their electrochemical gradient. The channel alternates between opened and closed conformations in response to the voltage difference across the membrane (PubMed:15361858). Can form functional homotetrameric channels and heterotetrameric channels that contain variable proportions of KCNA1, KCNA2, KCNA4, KCNA5, KCNA6, KCNA7, and possibly other family members as well; channel properties depend on the type of alpha subunits that are part of the channel. Channel properties are modulated by cytoplasmic beta subunits that regulate the subcellular location of the alpha subunits and promote rapid inactivation of delayed rectifier potassium channels (PubMed:15361858). In vivo, membranes probably contain a mixture of heteromeric potassium channel complexes, making it difficult to assign currents observed in intact tissues to any particular potassium channel family member. Homotetrameric KCNA1 forms a delayed-rectifier potassium channel that opens in response to membrane depolarization, followed by slow spontaneous channel closure (PubMed:7517498, PubMed:15361858). In contrast, a heterotetrameric channel formed by KCNA1 and KCNA4 shows rapid inactivation (By similarity). Regulates neuronal excitability in hippocampus, especially in mossy fibers and medial perforant path axons, preventing neuronal hyperexcitability (PubMed:23466697). May function as down-stream effector for G protein-coupled receptors and inhibit GABAergic inputs to basolateral amygdala neurons (By similarity). May contribute to the regulation of neurotransmitter release, such as gamma-aminobutyric acid (GABA) release (By similarity). Plays a role in regulating the generation of action potentials and preventing hyperexcitability in myelinated axons of the vagus nerve, and thereby contributes to the regulation of heart contraction (PubMed:20392939, PubMed:22641786, PubMed:25377007). Required for normal neuromuscular responses (PubMed:9736643). Regulates the frequency of neuronal action potential firing in response to mechanical stimuli, and plays a role in the perception of pain caused by mechanical stimuli, but does not play a role in the perception of pain due to heat stimuli (PubMed:23473320). Required for normal responses to auditory stimuli and precise location of sound sources, but not for sound perception (PubMed:21966978, PubMed:22396426). The use of toxins that block specific channels suggest that it contributes to the regulation of the axonal release of the neurotransmitter dopamine (PubMed:21233214). Required for normal postnatal brain development and normal proliferation of neuronal precursor cells in the brain (PubMed:8995755, PubMed:17250763, PubMed:17315199, PubMed:22411008). Plays a role in the reabsorption of Mg(2+) in the distal convoluted tubules in the kidney and in magnesium ion homeostasis, probably via its effect on the membrane potential (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222106 | Kcna1 (tGFP-tagged) - Mouse potassium voltage-gated channel shaker-related subfamily member 1 (Kcna1), (10ug) |
CNY 3,710.00 |
|
MR222106 | Kcna1 (Myc-DDK-tagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, member 1 (Kcna1) |
CNY 3,656.00 |
|
MR222106L3 | Lenti ORF clone of Kcna1 (Myc-DDK-tagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, member 1 (Kcna1) |
CNY 6,056.00 |
|
MR222106L4 | Lenti ORF clone of Kcna1 (mGFP-tagged) - Mouse potassium voltage-gated channel, shaker-related subfamily, member 1 (Kcna1) |
CNY 6,056.00 |