Integrin beta 4 binding protein (EIF6) (NM_181467) Human Untagged Clone

CAT#: SC109360

ITGB4BP (untagged)-Human integrin beta 4 binding protein (ITGB4BP), transcript variant 5



CNY 1,200.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-EIF6 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAB, EIF6, EIF3A, p27BBP, b(2)gcn
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_181467, the custom clone sequence may differ by one or more nucleotides


ATGGCGGTCCGAGCTTCGTTCGAGAACAACTGTGAGATCGGCTGCTTTGCCAAGCTCACCAACACCTACT
GTCTGGTAGCGATCGGAGGCTCAGAGAACTTCTACAGTGTGTTCGAGGGCGAGCTCTCCGATACCATCCC
CGTGGTGCACGCGTCTATCGCCGGCTGCCGCATCATCGGGCGCATGTGTGTGGGAGACAGAAGAAATTCT
GGCAGATGTGCTCAAGGTGGAAGTCTTCAGACAGACAGTGGCCGACCAGGTGCTAGTAGGAAGCTACTGT
GTCTTCAGCAATCAGGGAGGGCTGGTGCATCCCAAGACTTCAATTGA


>OriGene 5' read for NM_181467 unedited
NNTTGCGGTTCAGAATTGTATACGACTTCACTATAGGCGGCCGCGGAATTCGCACGAGGG
TCCAAGGTACAGTCGCCGCGTGCGGAGCTTGTTACTGGGGACTTGGCCTCATGGCGGTCC
GAGCTTCGTTCGAGAACAACTGTGAGATCGGCTGCTTTGCCAAGCTCACCAACACCTACT
GTGTGGTAGCGATCGGAGGCTCAGAGAACTTCTACAGTGTGTTCGAGGGCGAGCTCTCCG
ATACCATCCCCGTGGTGCACGCGTCTATCGCCGGCTGCCGCATCATCGGGCGCATGTGTG
TGGGGAACAGGCACGGTGCTCCTGGTACCCAACAATACCACCGACCAGGAGCTGCAACAC
ATTCGCAACAGCCTCCCAGACACAGTGCAGATTAGGCGGGTGGAGGAGCGGCTCTCAGCC
TTGGGCAATGTCACCACCTGGAATGACTACGTGGCCTTGGTCCACCCAGACTTGGACAGG
GAGACAGAAGAAATTCTGGCAGATGTGCTCAAGGGGGAAGTCTTCAGACAGACAGTGGCC
GACCAGGTGCTAGTAGGAAGCTACTGTGTCTTCAGCAATCAGGGAGGGCTGGTGCATCCC
AAGACTTCAATTGAAGACCAGGATGAGCTGTCCTCTCTTCTTCAAGTCCCCCTTGTGGCG
GGGACTGTGAACCNAGGCANTGAGGTGATTGCTGCTGGGATGGGGGTGAATGACTGGTGT
GCCTTCTGTGGCCTGGACACAACCANCACGGAGCTGTCANTGGGGGAGAGTGTCTTCAAG
CTGAATGAAGCCCAGCCTAGCACCATTGCCACCAGCATGCGGGATTCCCTCATTGACAGC
CTCACCTGGGTCACCTTCCAAGGTGGGTCCATGGGCTCCTG
Restriction Sites NotI-NotI     
ACCN NM_181467
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_181467.1, NP_852132.1
RefSeq Size 938 bp
RefSeq ORF 327 bp
Locus ID 3692
Protein Families Druggable Genome
Gene Summary Hemidesmosomes are structures which link the basal lamina to the intermediate filament cytoskeleton. An important functional component of hemidesmosomes is the integrin beta-4 subunit (ITGB4), a protein containing two fibronectin type III domains. The protein encoded by this gene binds to the fibronectin type III domains of ITGB4 and may help link ITGB4 to the intermediate filament cytoskeleton. The encoded protein, which is insoluble and found both in the nucleus and in the cytoplasm, can function as a translation initiation factor and prevent the association of the 40S and 60S ribosomal subunits. Multiple non-protein coding transcript variants and variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (5) lacks an alternate exon compared to variant 1, which causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. Both variants 3 and 5 encode isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

其它Integrin beta 4 binding protein产品

Customer Reviews 
Loading...