SF2 (SRSF1) (NM_006924) Human Untagged Clone
CAT#: SC115786
SRSF1 (untagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1
CNY 3,600.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASF; SF2; SF2p33; SFRS1; SRp30a |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_006924 edited
ATGTCGGGAGGTGGTGTGATTCGTGGCCCCGCAGGGAACAACGATTGCCGCATCTACGTG GGTAACTTACCTCCAGACATCCGAACCAAGGACATTGAGGACGTGTTCTACAAATACGGC GCTATCCGCGACATCGACCTCAAGAATCGCCGCGGGGGACCGCCCTTCGCCTTCGTTGAG TTCGAGGACCCGCGAGACGCGGAAGACGCGGTGTATGGTCGCGACGGCTATGATTACGAT GGGTACCGTCTGCGGGTGGAGTTTCCTCGAAGCGGCCGTGGAACAGGCCGAGGCGGCGGC GGGGGTGGAGGTGGCGGAGCTCCCCGAGGTCGCTATGGCCCCCCATCCAGGCGGTCTGAA AACAGAGTGGTTGTCTCTGGACTGCCTCCAAGTGGAAGTTGGCAGGATTTAAAGGATCAC ATGCGTGAAGCAGGTGATGTATGTTATGCTGATGTTTACCGAGATGGCACTGGTGTCGTG GAGTTTGTACGGAAAGAAGATATGACCTATGCAGTTCGAAAACTGGATAACACTAAGTTT AGATCTCATGAGGGAGAAACTGCCTACATCCGGGTTAAAGTTGATGGGCCCAGAAGTCCA AGTTATGGAAGATCTCGATCTCGAAGCCGTAGTCGTAGCAGAAGCCGTAGCAGAAGCAAC AGCAGGAGTCGCAGTTACTCCCCAAGGAGAAGCAGAGGATCACCACGCTATTCTCCCCGT CATAGCAGATCTCGCTCTCGTACATAA |
Restriction Sites | ECoRI-NOT |
ACCN | NM_006924 |
Insert Size | 2000 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_006924.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006924.1, NP_008855.1 |
RefSeq Size | 1428 bp |
RefSeq ORF | 747 bp |
Locus ID | 6426 |
UniProt ID | Q07955 |
Domains | RRM |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | Spliceosome |
Gene Summary | This gene encodes a member of the arginine/serine-rich splicing factor protein family. The encoded protein can either activate or repress splicing, depending on its phosphorylation state and its interaction partners. Multiple transcript variants have been found for this gene. There is a pseudogene of this gene on chromosome 13. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (1) encodes the longer isoform (1, also known as ASF-1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201636 | SRSF1 (Myc-DDK-tagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1 |
CNY 3,600.00 |
|
RC201636L1 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC201636L2 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RC201636L3 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC201636L4 | Lenti ORF clone of Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1, mGFP tagged |
CNY 6,000.00 |
|
RG201636 | SRSF1 (tGFP-tagged) - Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1 |
CNY 5,200.00 |
|
SC323930 | SRSF1 (untagged)-Human serine/arginine-rich splicing factor 1 (SRSF1), transcript variant 1 |
CNY 3,600.00 |