SLC35E2A (NM_182838) Human Untagged Clone
CAT#: SC126926
SLC35E2 (untagged)-Human solute carrier family 35, member E2 (SLC35E2), transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SLC35E2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_182838, the custom clone sequence may differ by one or more nucleotides
ATGTCGTCCTCGGTGAAAACCCCAGCACTGGAAGAGCTGGTTCCTGGCTCCGAAGAGAAGCCGAAAGGCA GGTCGCCTCTCAGCTGGGGCTCTCTGTTTGGTCACCGAAGTGAGAAGATTGTTTTTGCCAAGAGCGACGG CGGCACAGATGAGAACGTACTGACCGTCACCATCACGGAGACCACGGTCATCGAGTCAGACTTGGGTGTG TGGAGCTCGCGGGCGCTGCTCTACCTCACGCTGTGGTTCTTCTTCAGCTTCTGCACGCTCTTCCTCAACA AGTACATCCTGTCCCTGCTGGGAGGCGAGCCCAGCATGCTAGGTGCGGTGCAGATGCTGTCCACCACGGT TATCGGGTGTGTGAAAACCCTCGTTCCTTGCTGTTTATATCAGCACAAGGCCCGGCTTTCCTACCCACCC AACTTCCTTATGACGATGCTGTTTGTGGGTCTGATGAGGTTTGCAACTGTGGTTTTGGGTTTGGTCAGCC TGAAAAATGTGGCGGTTTCGTTTGCTGAGACGGTGAAGAGCTCCGCCCCCATCTTCACGGTGATCATGTC TCGGATGATTCTGGGGGAGTACACAGGACGTCCCAGTGATCGGGAGGAGCGGGAAGAGCTTCAGCTACAA CCAGGACGTGGTGCTGCTGCTTCTGACAGACGGAGTCCTGTTCCACCTTCAGAGCGTCACGGCGTACGCC CTCATGGGGAAAATCTCCCCGGTGACTTTCAGGTCCCGCAGGCCCTGCACCGAGTCGCCTTGTCCATGGC GCTGCCCTGCCCCATGCTTCCTGCGTCCTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_182838 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182838.1, NP_878258.1 |
RefSeq Size | 1430 bp |
RefSeq ORF | 801 bp |
Locus ID | 9906 |
UniProt ID | Q5CZA4 |
Protein Families | Transmembrane |
Gene Summary | Putative transporter.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216477 | SLC35E2 (Myc-DDK-tagged)-Human solute carrier family 35, member E2 (SLC35E2), transcript variant 1 |
CNY 2,400.00 |
|
RC216477L3 | Lenti ORF clone of Human solute carrier family 35, member E2 (SLC35E2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216477L4 | Lenti ORF clone of Human solute carrier family 35, member E2 (SLC35E2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG216477 | SLC35E2 (tGFP-tagged) - Human solute carrier family 35, member E2 (SLC35E2), transcript variant 1 |
CNY 4,000.00 |
其它SLC35E2A产品