PHF19 (NM_001009936) Human Untagged Clone

CAT#: SC301449

PHF19 (untagged)-Human PHD finger protein 19 (PHF19), transcript variant 2



  "NM_001009936" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-PHF19 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MTF2L1; PCL3; TDRD19B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301449 representing NM_001009936.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGAATCGAGCTCTGGATCCAGGGACTCGGGACTCCTATGGTGCCACCAGCCACCTCCCCAACAAG
GGGGCCCTGGCGAAGGTCAAGAACAACTTCAAAGACTTGATGTCCAAACTGACGGAGGGCCAGTATGTG
CTGTGCCGGTGGACAGATGGCCTGTACTACCTCGGGAAGATCAAGAGGGTCAGCAGCTCTAAGCAAAGC
TGCCTCGTGACTTTCGAAGATAATTCCAAATACTGGGTCCTATGGAAGGACATACAGCATGCCGGTGTT
CCAGGAGAGGAGCCCAAGTGCAACATCTGCCTAGGGAAGACATCAGGGCCGCTGAATGAGATCCTCATC
TGCGGGAAGTGTGGCCTGGGTTACCACCAGCAGTGCCACATCCCCATAGCGGGCAGTGCTGACCAGCCC
CTGCTCACACCTTGGTTCTGCCGACGCTGCATCTTCGCACTGGCTGTGCGGGTGAGCCTTCCATCCTCC
CCAGTCCCTGCCTCTCCTGCCTCCTCCAGTGGGGCAGACCAGAGACTCCCATCACAGAGTCTGAGCTCC
AAGCAGAAGGGCCACACCTGGGCTTTGGAGACAGATAGCGCCTCTGCCACTGTCCTTGGCCAGGATTTG
TAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001009936
Insert Size 624 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001009936.1
RefSeq Size 995 bp
RefSeq ORF 624 bp
Locus ID 26147
UniProt ID Q5T6S3
Protein Families Druggable Genome
MW 22.5 kDa
Gene Summary Polycomb group (PcG) that specifically binds histone H3 trimethylated at 'Lys-36' (H3K36me3) and recruits the PRC2 complex. Probably involved in the transition from an active state to a repressed state in embryonic stem cells: acts by binding to H3K36me3, a mark for transcriptional activation, and recruiting H3K36me3 histone demethylases RIOX1 or KDM2B, leading to demethylation of H3K36 and recruitment of the PRC2 complex that mediates H3K27me3 methylation, followed by de novo silencing. Recruits the PRC2 complex to CpG islands and contributes to embryonic stem cell self-renewal. Also binds dimethylated at 'Lys-36' (H3K36me2). Isoform 1 and isoform 2 inhibit transcription from an HSV-tk promoter.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) contains alternate exon structure in both the 5' and 3' regions, and it thus differs in both UTRs, initiates translation from a downstream in-frame start codon, and includes an alternate 3' coding region, compared to variant 3. The encoded isoform (b, also known as hPCL3S) is shorter at the N-terminus and has a distinct C-terminus, compared to isoform c.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...