DKKL1 (NM_014419) Human Untagged Clone
CAT#: SC304097
DKKL1 (untagged)-Human dickkopf-like 1 (DKKL1), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT34; SGY; SGY-1; SGY1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_014419 edited
GGCTTTAACAGTACGTGGGCGGCCGGAATCCGGGAGTCCGGTGACCCGGGCTGTGGTCTA GCATAAAGGCGGAGCCCAGAAGAAGGGGCGGGGTATGGGAGAAGCCTCCCCACCTGCCCC CGCAAGGCGGCATCTGCTGGTCCTGCTGCTGCTCCTCTCTACCCTGGTGATCCCCTCCGC TGCAGCTCCTATCCATGATGCTGACGCCCAAGAGAGCTCCTTGGGTCTCACAGGCCTCCA GAGCCTACTCCAAGGCTTCAGCCGACTTTTCCTGAAAGGTAACCTGCTTCGGGGCATAGA CAGCTTATTCTCTGCCCCCATGGACTTCCGGGGCCTCCCTGGGAACTACCACAAAGAGGA GAACCAGGAGCACCAGCTGGGGAACAACACCCTCTCCAGCCACCTCCAGATCGACAAGAT GACCGACAACAAGACAGGAGAGGTGCTGATCTCCGAGAATGTGGTGGCATCCATTCAACC AGCGGAGGGGAGCTTCGAGGGTGATTTGAAGGTACCCAGGATGGAGGAGAAGGAGGCCCT GGTACCCATCCAGAAGGCCACGGACAGCTTCCACACAGAACTCCATCCCCGGGTGGCCTT CTGGATCATTAAGCTGCCACGGCGGAGGTCCCACCAGGATGCCCTGGAGGGCGGCCACTG GCTCAGCGAGAAGCGACACCGCCTGCAGGCCATCCGGGATGGACTCCGCAAGGGGACCCA CAAGGACGTCCTAGAAGAGGGGACCGAGAGCTCCTCCCACTCCAGGCTGTCCCCCCGAAA GACCCACTTACTGTACATCCTCAGGCCCTCTCGGCAGCTGTAGGGGTGGGGACCGGGGAG CACCTGCCTGTAGCCCCCATCAGACCCTGCCCCAAGCACCATATGGAAATAAAGTTCTTT CTTACATCCAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_014419 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_014419.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_014419.3, NP_055234.1 |
RefSeq Size | 1034 bp |
RefSeq ORF | 729 bp |
Locus ID | 27120 |
UniProt ID | Q9UK85 |
Protein Families | ES Cell Differentiation/IPS, Secreted Protein, Transmembrane |
Gene Summary | The dickkopf protein family interacts with the Wnt signaling pathway and its members are characterized by two conserved cysteine-rich domains. This gene encodes a secreted protein that has low sequence similarity to the dickkopf-3 protein. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Oct 2010] Transcript Variant: This variant (1) encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205209 | DKKL1 (Myc-DDK-tagged)-Human dickkopf-like 1 (DKKL1), transcript variant 1 |
CNY 2,640.00 |
|
RC205209L3 | Lenti-ORF clone of DKKL1 (Myc-DDK-tagged)-Human dickkopf-like 1 (DKKL1), transcript variant 1 |
CNY 5,890.00 |
|
RC205209L4 | Lenti-ORF clone of DKKL1 (mGFP-tagged)-Human dickkopf-like 1 (DKKL1), transcript variant 1 |
CNY 5,890.00 |
|
RG205209 | DKKL1 (tGFP-tagged) - Human dickkopf-like 1 (DKKL1), transcript variant 1 |
CNY 4,370.00 |