United States
Germany
Japan
United Kingdom
China
C6orf57 (SDHAF4) (NM_145267) Human Untagged Clone
CAT＃: SC306238
C6orf57 (untagged)-Human chromosome 6 open reading frame 57 (C6orf57)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C6orf57; Sdh8 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_145267, the custom clone sequence may differ by one or more nucleotides
ATGACCCCATCGAGGCTTCCCTGGTTGCTTAGCTGGGTCTCGGCCACGGCGTGGAGAGCGGCAAGATCAC CCCTTCTGTGTCATTCTCTGAGGAAAACAAGTTCTTCTCAAGGAGGAAAGTCTGAACTTGTCAAACAGTC CCTTAAGAAGCCGAAGTTACCAGAAGGTCGTTTTGATGCACCAGAGGATTCCCATTTAGAGAAAGAACCA CTGGAAAAATTTCCAGATGATGTTAATCCAGTGACCAAAGAAAAAGGTGGACCCAGGGGCCCAGAACCTA CCCGATATGGAGATTGGGAACGAAAAGGACGCTGTATTGATTTTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_145267 |
| Insert Size | 1300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_145267.2, NP_660310.2 |
| RefSeq Size | 526 bp |
| RefSeq ORF | 327 bp |
| Locus ID | 135154 |
| UniProt ID | Q5VUM1 |
| Protein Families | Secreted Protein |
| Gene Summary | Plays an essential role in the assembly of succinate dehydrogenase (SDH), an enzyme complex (also referred to as respiratory complex II) that is a component of both the tricarboxylic acid (TCA) cycle and the mitochondrial electron transport chain, and which couples the oxidation of succinate to fumarate with the reduction of ubiquinone (coenzyme Q) to ubiquinol (PubMed:24954416). Binds to the flavoprotein subunit SDHA in its FAD-bound form, blocking the generation of excess reactive oxigen species (ROS) and facilitating its assembly with the iron-sulfur protein subunit SDHB into the SDH catalytic dimer (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205542 | C6orf57 (Myc-DDK-tagged)-Human chromosome 6 open reading frame 57 (C6orf57) |
CNY 1,200.00 |
|
| RC205542L1 | Lenti ORF clone of Human chromosome 6 open reading frame 57 (C6orf57), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC205542L2 | Lenti ORF clone of Human chromosome 6 open reading frame 57 (C6orf57), mGFP tagged |
CNY 5,890.00 |
|
| RC205542L3 | Lenti ORF clone of Human chromosome 6 open reading frame 57 (C6orf57), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC205542L4 | Lenti ORF clone of Human chromosome 6 open reading frame 57 (C6orf57), mGFP tagged |
CNY 5,890.00 |
|
| RG205542 | C6orf57 (tGFP-tagged) - Human chromosome 6 open reading frame 57 (C6orf57) |
CNY 2,800.00 |
其它C6orf57产品
