EMG1 (NM_006331) Human Untagged Clone

CAT#: SC315700

EMG1 (untagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1)



  "NM_006331" in other vectors (7)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-EMG1 mouse monoclonal antibody, clone OTI1B8 (formerly 1B8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C2F; Grcc2f; NEP1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_006331, the custom clone sequence may differ by one or more nucleotides


ATGGCCGCGCCCAGTGATGGATTCAAGCCTCGTGAACGAAGCGGTGGGGAGCAGGCACAGGACTGGGATG
CTCTGCCACCCAAGCGGCCCCGACTAGGGGCAGGAAACAAGATCGGAGGCCGTAGGCTTATTGTGGTGCT
GGAAGGGGCCAGTCTGGAGACAGTCAAGGTAGGGAAGACATATGAGCTACTCAACTGTGACAAGCACAAG
TCTATATTGTTGAAGAATGGACGGGACCCTGGGGAAGCGCGGCCAGATATCACCCACCAGAGTTTGCTGA
TGCTGATGGATAGTCCCCTGAACCGAGCTGGCTTGCTACAGGTTTATATCCATACACAGAAGAATGTTCT
GATTGAAGTGAATCCCCAGACCCGAATTCCCAGAACCTTTGACCGCTTTTGTGGCCTCATGGTTCAACTT
TTACACAAGCTCAGTGTTCGAGCAGCTGATGGCCCCCAGAAGCTTTTGAAGGTAATTAAGAATCCAGTAT
CAGATCACTTTCCAGTTGGATGTATGAAAGTTGGCACTTCTTTTTCCATCCCGGTTGTCAGTGATGTGCG
TGAGCTGGTGCCCAGCAGTGATCCTATTGTTTTTGTGGTAGGGGCCTTTGCCCATGGCAAGGTCAGTGTG
GAGTATACAGAGAAGATGGTGTCCATCAGTAACTACCCCCTTTCTGCTGCCCTCACCTGTGCAAAACTTA
CCACAGCCTTTGAGGAAGTATGGGGGGTCATTTGA


Restriction Sites Please inquire     
ACCN NM_006331
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006331.4, NP_006322.2
RefSeq Size 1019 bp
RefSeq ORF 735 bp
Locus ID 10436
UniProt ID Q92979
Domains Mra1
Gene Summary This gene encodes an essential, conserved eukaryotic protein that methylates pseudouridine in 18S rRNA. The related protein in yeast is a component of the small subunit processome and is essential for biogenesis of the ribosomal 40S subunit. A mutation in this gene has been associated with Bowen-Conradi syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Transcript Variant: This variant (1) encodes the longer isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...