EMG1 (NM_006331) Human Untagged Clone
CAT#: SC315700
EMG1 (untagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C2F; Grcc2f; NEP1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_006331, the custom clone sequence may differ by one or more nucleotides
ATGGCCGCGCCCAGTGATGGATTCAAGCCTCGTGAACGAAGCGGTGGGGAGCAGGCACAGGACTGGGATG CTCTGCCACCCAAGCGGCCCCGACTAGGGGCAGGAAACAAGATCGGAGGCCGTAGGCTTATTGTGGTGCT GGAAGGGGCCAGTCTGGAGACAGTCAAGGTAGGGAAGACATATGAGCTACTCAACTGTGACAAGCACAAG TCTATATTGTTGAAGAATGGACGGGACCCTGGGGAAGCGCGGCCAGATATCACCCACCAGAGTTTGCTGA TGCTGATGGATAGTCCCCTGAACCGAGCTGGCTTGCTACAGGTTTATATCCATACACAGAAGAATGTTCT GATTGAAGTGAATCCCCAGACCCGAATTCCCAGAACCTTTGACCGCTTTTGTGGCCTCATGGTTCAACTT TTACACAAGCTCAGTGTTCGAGCAGCTGATGGCCCCCAGAAGCTTTTGAAGGTAATTAAGAATCCAGTAT CAGATCACTTTCCAGTTGGATGTATGAAAGTTGGCACTTCTTTTTCCATCCCGGTTGTCAGTGATGTGCG TGAGCTGGTGCCCAGCAGTGATCCTATTGTTTTTGTGGTAGGGGCCTTTGCCCATGGCAAGGTCAGTGTG GAGTATACAGAGAAGATGGTGTCCATCAGTAACTACCCCCTTTCTGCTGCCCTCACCTGTGCAAAACTTA CCACAGCCTTTGAGGAAGTATGGGGGGTCATTTGA |
Restriction Sites | Please inquire |
ACCN | NM_006331 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006331.4, NP_006322.2 |
RefSeq Size | 1019 bp |
RefSeq ORF | 735 bp |
Locus ID | 10436 |
UniProt ID | Q92979 |
Domains | Mra1 |
Gene Summary | This gene encodes an essential, conserved eukaryotic protein that methylates pseudouridine in 18S rRNA. The related protein in yeast is a component of the small subunit processome and is essential for biogenesis of the ribosomal 40S subunit. A mutation in this gene has been associated with Bowen-Conradi syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC208885 | EMG1 (Myc-DDK-tagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1) |
CNY 2,400.00 |
|
RC208885L1 | Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC208885L2 | Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), mGFP tagged |
CNY 5,890.00 |
|
RC208885L3 | Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC208885L4 | Lenti ORF clone of Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1), mGFP tagged |
CNY 5,890.00 |
|
RG208885 | EMG1 (tGFP-tagged) - Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1) |
CNY 4,000.00 |
|
SC321124 | EMG1 (untagged)-Human EMG1 nucleolar protein homolog (S. cerevisiae) (EMG1) |
CNY 2,400.00 |