United States
Germany
Japan
United Kingdom
China
DMP1 (NM_001079911) Human Untagged Clone
CAT＃: SC315785
DMP1 (untagged)-Human dentin matrix acidic phosphoprotein 1 (DMP1), transcript variant 2
CNY 7,980.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ARHP; ARHR; DMP-1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001079911, the custom clone sequence may differ by one or more nucleotides
ATGAAGATCAGCATCCTGCTCATGTTCCTTTGGGGATTATCCTGTGCTCTCCCAGTAACCAGGTATCAAA ATAATGAATCTGAGGATTCTGAAGAATGGAAGGGTCATTTGGCTCAGGCACCAACACCACCCTTGGCAAA TGAAGACCCCAGTGACAGCACTCAGTCAGAGGAGGGCCTGGGCTCTGATGATCATCAATACATTTATAGG CTAGCTGGTGGCTTCTCCAGGAGCACAGGAAAAGGAGGAGATGATAAAGATGACGATGAAGATGACAGTG GAGATGACACCTTTGGTGACGATGACAGTGGCCCAGGGCCCAAAGACAGACAAGAAGGAGGAAACTCCAG ACTGGGAAGTGATGAGGACTCTGATGACACCATACAAGCCAGTGAAGAGAGTGCCCCACAAGGGCAAGAC AGTGCCCAAGATACCACCAGTGAGAGCAGGGAACTTGACAATGAGGACCGGGTGGACAGCAAGCCTGAGG GAGGTGACTCCACTCAAGAGAGTGAGAGTGAAGAGCACTGGGTGGGAGGTGGCAGTGATGGGGAGAGCAG CCATGGAGACGGCTCCGAGTTGGACGATGAGGGAATGCAGAGTGATGACCCAGAGAGCATCAGGAGTGAA AGGGGAAACTCCAGAATGAACAGTGCAGGCATGAAATCAAAAGAATCTGGAGAAAACAGTGAGCAAGCAA ACACTCAAGATTCAGGTGGCAGCCAATTGCTGGAGCATCCCAGTAGGAAAATTTTTAGGAAGTCTCGCAT CTCAGAGGAAGATGACAGAAGCGAGCTTGATGACAACAACACAATGGAAGAAGTCAAGAGTGACTCTACA GAAAACAGCAACTCCAGAGACACTGGCCTCAGCCAACCCAGGAGAGACAGCAAGGGTGACTCTCAAGAAG ACAGCAAGGAGAATCTGTCCCAGGAAGAGAGCCAAAACGTAGATGGTCCCAGCAGTGAGTCCAGCCAAGA GGCCAACCTGTCATCTCAAGAGAACAGCAGTGAGTCTCAGGAAGAGGTGGTGAGTGAGTCCAGGGGAGAT AACCCCGACCCCACAACTAGTTATGTAGAAGACCAGGAAGACAGTGACTCCAGCGAGGAGGACAGCTCGC ACACACTCTCCCACTCAAAAAGTGAATCCAGAGAGGAGCAAGCAGACAGCGAATCCAGTGAGAGCCTCAA CTTCTCAGAGGAAAGCCCGGAGTCCCCTGAGGATGAGAACAGCTCCAGCCAGGAGGGCCTCCAGTCTCAC AGCAGCTCAGCAGAGAGTCAGAGCGAGGAAAGCCATTCTGAGGAAGACGACAGTGACTCTCAAGACAGCA GCAGATCCAAAGAAGATAGCAACTCCACGGAGAGCAAATCAAGCAGTGAGGAAGATGGCCAGTTGAAAAA CATTGAGATAGAGAGCCGGAAATTAACAGTTGATGCCTATCACAACAAACCCATTGGGGACCAAGATGAC AATGACTGCCAAGACGGCTATTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001079911 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001079911.1, NP_001073380.1 |
| RefSeq Size | 2631 bp |
| RefSeq ORF | 1494 bp |
| Locus ID | 1758 |
| UniProt ID | Q13316 |
| Protein Families | Secreted Protein |
| Gene Summary | Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an internal in-frame exon, compared to variant 1, resulting in a protein (isoform 2) that is 16 aa shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments and data in PMID:15108359. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222208 | DMP1 (Myc-DDK-tagged)-Human dentin matrix acidic phosphoprotein 1 (DMP1), transcript variant 2 |
CNY 3,656.00 |
|
| RC222208L3 | Lenti ORF clone of Human dentin matrix acidic phosphoprotein 1 (DMP1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC222208L4 | Lenti ORF clone of Human dentin matrix acidic phosphoprotein 1 (DMP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG222208 | DMP1 (tGFP-tagged) - Human dentin matrix acidic phosphoprotein 1 (DMP1), transcript variant 2 |
CNY 4,370.00 |
