NKX2.3 (NKX2-3) (NM_145285) Human Untagged Clone

CAT#: SC317582

NKX2 (untagged)-Human NK2 transcription factor related, locus 3 (Drosophila) (NKX2-3)



  "NM_145285" in other vectors (7)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal Anti-NKX2-3 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CSX3; NK2.3; NKX2.3; NKX2C; NKX4-3
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene ORF sequence for NM_145285 edited
ATGATGTTACCAAGCCCGGTCACCTCCACCCCTTTCTCAGTCAAAGACATTTTGAATCTG
GAGCAGCAGCACCAGCACTTCCATGGTGCGCACTTGCAGGCGGACTTGGAGCACCACTTC
CACTCTGCGCCCTGCATGCTGGCCGCCGCTGAGGGGACGCAATTTTCTGACGGAGGGGAG
GAGGACGAGGAAGACGAGGGCGAGAAATTGTCCTATTTGAACTCACTAGCCGCAGCAGAC
GGCCACGGGGATTCAGGGCTGTGTCCCCAGGGCTATGTCCACACGGTCCTGCGAGACTCG
TGCAGCGAGCCCAAGGAACATGAAGAGGAGCCCGAGGTCGTGAGGGACCGGAGCCAAAAA
AGCTGCCAGCTGAAGAAGTCTCTAGAGACGGCCGGAGACTGCAAGGCGGCGGAGGAGAGC
GAGAGGCCGAAGCCACGCAGCCGCCGGAAGCCCCGGGTCCTCTTCTCGCAAGCCCAGGTC
TTCGAGCTGGAACGCAGGTTCAAGCAGCAGCGGTACCTGTCGGCACCCGAGCGCGAGCAC
CTCGCCAGCAGCCTGAAGCTCACATCCACTCAGGTGAAAATCTGGTTCCAGAATCGCAGG
TACAAGTGCAAGAGACAGCGGCAGGACAAGTCTCTGGAGCTTGGCGCACACGCGCCCCCG
CCGCCGCCGCGCCGCGTGGCTGTCCCGGTGCTGGTGCGGGACGGCAAGCCGTGCGTCACG
CCCAGCGCGCAGGCCTACGGCGCGCCCTACAGCGTGGGCGCCAGCGCCTACTCCTACAAC
AGCTTCCCCGCCTACGGCTATGGGAACTCGGCCGCGGCCGCCGCCGCCGCCGCCGCCGCC
GCCGCAGCAGCGGCGGCCTACAGCAGCAGCTATGGCTGTGCGTACCCGGCGGGCGGCGGC
GGCGGCGGCGGCGGGACCTCCGCGGCGACCACTGCCATGCAGCCCGCCTGCAGCGCGGCC
GGAGGCGGCCCCTTTGTGAACGTGAGCAACCTAGGAGGCTTCGGCAGCGGCGGCAGCGCA
CAGCCGTTGCACCAGGGTACTGCAGCCGGGGCCGCGTGCGCTCAGGGCACCTTGCAGGGC
ATCCGGGCCTGGTGA
Restriction Sites Please inquire     
ACCN NM_145285
Insert Size 1100 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_145285.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_145285.2, NP_660328.2
RefSeq Size 2117 bp
RefSeq ORF 1095 bp
Locus ID 159296
UniProt ID Q8TAU0
Domains homeobox
Protein Families Transcription Factors
Gene Summary This gene encodes a homeodomain-containing transcription factor. The encoded protein is a member of the NKX family of homeodomain transcription factors. Studies of similar proteins in mouse and rat have indicated a potential role in cellular differentiation.[provided by RefSeq, Mar 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...