TDP43 (TARDBP) (NM_007375) Human Untagged Clone
CAT#: SC322765
TARDBP (untagged)-Human TAR DNA binding protein (TARDBP)
CNY 5,488.00
Product images
CNY 1,999.00
CNY 3,600.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ALS10; TDP-43 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322765 representing NM_007375.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCTGAATATATTCGGGTAACCGAAGATGAGAACGATGAGCCCATTGAAATACCATCGGAAGACGAT GGGACGGTGCTGCTCTCCACGGTTACAGCCCAGTTTCCAGGGGCGTGTGGGCTTCGCTACAGGAATCCA GTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTAGAAGGAATTCTGCATGCCCCAGATGCTGGCTGGGGA AATCTGGTGTATGTTGTCAACTATCCAAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCA GCAGTGAAAGTGAAAAGAGCAGTCCAGAAAACATCCGATTTAATAGTGTTGGGTCTCCCATGGAAAACA ACCGAACAGGACCTGAAAGAGTATTTTAGTACCTTTGGAGAAGTTCTTATGGTGCAGGTCAAGAAAGAT CTTAAGACTGGTCATTCAAAGGGGTTTGGCTTTGTTCGTTTTACGGAATATGAAACACAAGTGAAAGTA ATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGCAAACTTCCTAATTCTAAGCAAAGCCAA GATGAGCCTTTGAGAAGCAGAAAAGTGTTTGTGGGGCGCTGTACAGAGGACATGACTGAGGATGAGCTG CGGGAGTTCTTCTCTCAGTACGGGGATGTGATGGATGTCTTCATCCCCAAGCCATTCAGGGCCTTTGCC TTTGTTACATTTGCAGATGATCAGATTGCGCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATC AGCGTTCATATATCCAATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTT GGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTG GGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATG ATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAAC CAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGT TCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCA GGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATG TAG |
Restriction Sites | RsrII-NotI |
ACCN | NM_007375 |
Insert Size | 1245 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_007375.3 |
RefSeq Size | 4236 bp |
RefSeq ORF | 1245 bp |
Locus ID | 23435 |
UniProt ID | Q13148 |
Domains | RRM |
Protein Families | Transcription Factors |
MW | 44.7 kDa |
Gene Summary | HIV-1, the causative agent of acquired immunodeficiency syndrome (AIDS), contains an RNA genome that produces a chromosomally integrated DNA during the replicative cycle. Activation of HIV-1 gene expression by the transactivator Tat is dependent on an RNA regulatory element (TAR) located downstream of the transcription initiation site. The protein encoded by this gene is a transcriptional repressor that binds to chromosomally integrated TAR DNA and represses HIV-1 transcription. In addition, this protein regulates alternate splicing of the CFTR gene. A similar pseudogene is present on chromosome 20. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210639 | TARDBP (Myc-DDK-tagged)-Human TAR DNA binding protein (TARDBP) |
CNY 3,656.00 |
|
RC210639L1 | Lenti ORF clone of Human TAR DNA binding protein (TARDBP), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC210639L2 | Lenti ORF clone of Human TAR DNA binding protein (TARDBP), mGFP tagged |
CNY 6,056.00 |
|
RC210639L3 | Lenti ORF clone of Human TAR DNA binding protein (TARDBP), Myc-DDK-tagged |
CNY 6,056.00 |
|
RC210639L4 | Lenti ORF clone of Human TAR DNA binding protein (TARDBP), mGFP tagged |
CNY 6,056.00 |
|
RG210639 | TARDBP (tGFP-tagged) - Human TAR DNA binding protein (TARDBP) |
CNY 5,256.00 |
|
SC115570 | TARDBP (untagged)-Human TAR DNA binding protein (TARDBP) |
CNY 5,488.00 |