ZNF323 (ZSCAN31) (NM_001243244) Human Untagged Clone

CAT#: SC331976

ZSCAN31 (untagged) - Homo sapiens zinc finger and SCAN domain containing 31 (ZSCAN31), transcript variant 6



  "NM_001243244" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-ZNF323 Antibody
    • 100 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ZNF20-Lp; ZNF310P; ZNF323
Vector pCMV6-Entry
Sequence Data
>SC331976 representing NM_001243244.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGACACAGCTCAGATATGAATCTTTTTGCCTCCACCAATTTCAAGAACAAGATGGTGAAAGTATA
CCTGAGAACCAGGAGTTGGCATCAAAGCAAGAAATCTTAAAAGAAATGGAACATTTGGGGGATAGCAAA
CTCCAAAGAGATGTATCTTTGGATTCTAAGTACAGAGAAACTTGTAAACGAGACAGCAAGGCAGAAAAG
CAGCAGGCACATTCCACTGGAGAGAGACGCCACAGGTGCAATGAATGTGGGAAAAGCTTCACTAAGAGT
TCAGTACTCATTGAGCACCAGAGAATCCACACTGGGGAGAAGCCATATGAATGTGAAGAATGTGGGAAG
GCCTTCAGCCGGAGGTCAAGCCTGAATGAACATCGGCGGAGCCACACTGGAGAGAAACCCTATCAATGT
AAGGAGTGTGGGAAAGCCTTCAGTGCCAGCAATGGCCTCACTCGACACAGAAGAATCCACACAGGGGAA
AAACCATATGAATGCAAAGTGTGTGGGAAGGCTTTCCTCCTCAGCTCATGCCTTGTTCAGCATCAGAGG
ATACACACTGGAGAGAAGCGCTATCAGTGTCGTGAGTGTGGCAAAGCCTTCATTCAGAATGCAGGGCTT
TTCCAGCATCTCCGAGTCCACACTGGTGAGAAACCCTATCAGTGCAGTCAGTGCAGTAAACTCTTTAGT
AAGCGGACACTTCTTAAGAAACATCAGAAAATCCACACTGGAGAGAGACCATAA

Restriction Sites SgfI-MluI     
ACCN NM_001243244
Insert Size 744 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001243244.1
RefSeq Size 2581 bp
RefSeq ORF 744 bp
Locus ID 64288
UniProt ID Q96LW9
Protein Families Transcription Factors
MW 28.7 kDa
Gene Summary This gene encodes a protein containing multiple C2H2-type zinc finger motifs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (6) lacks a portion of the 5' coding region and uses a downstream, in-frame start codon, compared to variant 1. Variants 5, 6 and 8 encode the same isoform (2), which has a shorter N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...