GIRK1 (KCNJ3) (NM_001260508) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	GIRK1; KGA; KIR3.1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC332748 representing NM_001260508. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTCTGCACTCCGAAGGAAATTTGGGGACGATTATCAGGTAGTGACCACATCGTCCAGCGGCTCGGGC TTGCAGCCCCAGGGGCCAGGCCAGGACCCTCAGCAGCAGCTTGTGCCCAAGAAGAAGCGGCAGCGGTTC GTGGACAAGAACGGCCGGTGCAATGTACAGCACGGCAACCTGGGCAGCGAGACAAGCCGCTACCTCTCG GACCTCTTCACCACGCTGGTGGACCTCAAGTGGCGCTGGAACCTCTTCATCTTCATTCTCACCTACACC GTGGCCTGGCTTTTCATGGCGTCCATGTGGTGGGTGATCGCCTACACTCGGGGCGACCTGAACAAAGCC CACGTCGGTAACTACACGCCTTGCGTGGCCAATGTCTATAACTTCCCTTCTGCCTTCCTCTTCTTCATC GAGACGGAGGCCACCATCGGCTATGGCTACCGATACATCACAGACAAGTGCCCCGAGGGCATCATCCTC TTCCTCTTCCAGTCCATCCTGGGCTCCATCGTGGACGCCTTCCTCATCGGCTGCATGTTCATCAAGATG TCCCAGCCCAAGAAGCGCGCCGAGACCCTCATGTTCAGCGAGCACGCGGTGATCTCCATGAGGGACGGA AAACTCACGCTTATGTTCCGGGTGGGCAACCTGCGCAACAGCCACATGGTCTCCGCGCAGATTCGCTGC AAGCTGCTCAAAGGATGA
Restriction Sites	SgfI-MluI
ACCN	NM_001260508
Insert Size	708 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note	Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq	NM_001260508.1
RefSeq Size	4523 bp
RefSeq ORF	708 bp
Locus ID	3760
UniProt ID	P48549
Protein Families	Druggable Genome, Ion Channels: Potassium, Transmembrane
MW	26.8 kDa
Gene Summary	Potassium channels are present in most mammalian cells, where they participate in a wide range of physiologic responses. The protein encoded by this gene is an integral membrane protein and inward-rectifier type potassium channel. The encoded protein, which has a greater tendency to allow potassium to flow into a cell rather than out of a cell, is controlled by G-proteins and plays an important role in regulating heartbeat. It associates with three other G-protein-activated potassium channels to form a heteromultimeric pore-forming complex that also couples to neurotransmitter receptors in the brain and whereby channel activation can inhibit action potential firing by hyperpolarizing the plasma membrane. These multimeric G-protein-gated inwardly-rectifying potassium (GIRK) channels may play a role in the pathophysiology of epilepsy, addiction, Down's syndrome, ataxia, and Parkinson's disease. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, May 2012] Transcript Variant: This variant (2) lacks an exon in the coding region, compared to variant 1. This difference results in a frameshift and a protein (isoform 2; also known as GIRK1d) with a truncated C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.