STAC3 (NM_001286257) Human Untagged Clone
CAT#: SC334205
STAC3 (untagged) - Human SH3 and cysteine rich domain 3 (STAC3), transcript variant 3
CNY 2,950.00
货期*
3周
规格
Product images
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MYPBB; NAM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001286257, the custom clone sequence may differ by one or more nucleotides
ATGGCAAACAAGGAACGGAAGAAGGGACAGGCAGATAAGAAAAATCCTGTAGCAGCCATGATGGAGGAGG AGCCAGAGTCGGCCAGACCAGAGGAAGGCAAACCCCAGGATGGAAACCCTGAAGGGGATAAGAAGGCTGA GAAGAAGACACCTGATGACAAGCACAAGCAGCCTGGCTTCCAGCAGTCTCATTACTTTGTGGCTCTCTAT CGGTTCAAAGCCCTGGAGAAGGACGATCTGGATTTCCCGCCAGGAGAGAAGATCACAGTCATTGATGACT CCAATGAAGAATGGTGGCGGGGGAAAATCGGGGAGAAGGTCGGATTTTTCCCTCCAAACTTCATCATTCG GGTCCGGGCTGGAGAACGTGTGCACCGCGTGACGAGATCCTTCGTGGGGAACCGCGAGATAGGGCAGATC ACTCTCAAGAAGGACCAGATCGTGGTGCAGAAAGGAGACGAAGCGGGCGGCTACGTCAAGGTCTACACCG GCCGCAAGGTGGGGCTGTTTCCCACCGACTTTCTAGAGGAAATTTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001286257 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001286257.1, NP_001273186.1 |
RefSeq Size | 1235 bp |
RefSeq ORF | 537 bp |
Locus ID | 246329 |
UniProt ID | Q96MF2 |
Gene Summary | The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (c) has a shorter N-terminus than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...