CDT2 (DTL) (NM_001286229) Human Untagged Clone

CAT#: SC336242

DTL (untagged) - Human denticleless E3 ubiquitin protein ligase homolog (Drosophila) (DTL), transcript variant 2



  "NM_001286229" in other vectors (2)

CNY 4,370.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


DTL rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDT2; DCAF2; L2DTL; RAMP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC336242 representing NM_001286229.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGATATTCAAGTCTGATTTTGGATTCCACTGGCTCTACTTTATTTGCTAATTGCACAGACGATAAC
ATCTACATGTTTAATATGACTGGGTTGAAGACTTCTCCAGTGGCTATTTTCAATGGACACCAGAACTCT
ACCTTTTATGTAAAATCCAGCCTTAGTCCAGATGACCAGTTTTTAGTCAGTGGCTCAAGTGATGAAGCT
GCCTACATATGGAAGGTCTCCACACCCTGGCAACCTCCTACTGTGCTCCTGGGTCATTCTCAAGAGGTC
ACGTCTGTGTGCTGGTGTCCATCTGACTTCACAAAGATTGCTACCTGTTCTGATGACAATACACTAAAA
ATCTGGCGCTTGAATAGAGGCTTAGAGGAGAAACCAGGAGGTGATAAACTTTCCACGGTGGGTTGGGCC
TCTCAGAAGAAAAAAGAGTCAAGACCTGGCCTAGTAACAGTAACGAGTAGCCAGAGTACTCCTGCCAAA
GCCCCCAGGGTAAAGTGCAATCCATCCAATTCTTCCCCGTCATCCGCAGCTTGTGCCCCAAGCTGTGCT
GGAGACCTCCCTCTTCCTTCAAATACTCCTACGTTCTCTATTAAAACCTCTCCTGCCAAGGCCCGGTCT
CCCATCAACAGAAGAGGCTCTGTCTCCTCCGTCTCTCCCAAGCCACCTTCATCTTTCAAGATGTCGATT
AGAAACTGGGTGACCCGAACACCTTCCTCATCACCACCCATCACTCCACCTGCTTCGGAGACCAAGATC
ATGTCTCCGAGAAAAGCCCTTATTCCTGTGAGCCAGAAGTCATCCCAAGCAGAGGCTTGCTCTGAGTCT
AGAAATAGAGTAAAGAGGAGGCTAGACTCAAGCTGTCTGGAGAGTGTGAAACAAAAGTGTGTGAAGAGT
TGTAACTGTGTGACTGAGCTTGATGGCCAAGTTGAAAATCTTCATTTGGATCTGTGCTGCCTTGCTGGT
AACCAGGAAGACCTTAGTAAGGACTCTCTAGGTCCTACCAAATCAAGCAAAATTGAAGGAGCTGGTACC
AGTATCTCAGAGCCTCCGTCTCCTATCAGTCCGTATGCTTCAGAAAGCTGTGGAACGCTACCTCTTCCT
TTGAGACCTTGTGGAGAAGGGTCTGAAATGGTAGGCAAAGAGAATAGTTCCCCAGAGAATAAAAACTGG
TTGTTGGCCATGGCAGCCAAACGGAAGGCTGAGAATCCATCTCCACGAAGTCCGTCATCCCAGACACCC
AATTCCAGGAGACAGAGCGGAAAGACATTGCCAAGCCCGGTCACCATCACGCCCAGCTCCATGAGGAAA
ATCTGCACATACTTCCATAGAAAGTCCCAGGAGGACTTCTGTGGTCCTGAACACTCAACAGAATTATAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286229
Insert Size 1380 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286229.1
RefSeq Size 4381 bp
RefSeq ORF 1380 bp
Locus ID 51514
UniProt ID Q9NZJ0
Protein Families Druggable Genome
MW 49.4 kDa
Gene Summary Substrate-specific adapter of a DCX (DDB1-CUL4-X-box) E3 ubiquitin-protein ligase complex required for cell cycle control, DNA damage response and translesion DNA synthesis. The DCX(DTL) complex, also named CRL4(CDT2) complex, mediates the polyubiquitination and subsequent degradation of CDT1, CDKN1A/p21(CIP1), FBH1, KMT5A and SDE2 (PubMed:16861906, PubMed:16949367, PubMed:16964240, PubMed:17085480, PubMed:18703516, PubMed:18794347, PubMed:18794348, PubMed:19332548, PubMed:20129063, PubMed:23478441, PubMed:23478445, PubMed:23677613, PubMed:27906959). CDT1 degradation in response to DNA damage is necessary to ensure proper cell cycle regulation of DNA replication (PubMed:16861906, PubMed:16949367, PubMed:17085480). CDKN1A/p21(CIP1) degradation during S phase or following UV irradiation is essential to control replication licensing (PubMed:18794348, PubMed:19332548). KMT5A degradation is also important for a proper regulation of mechanisms such as TGF-beta signaling, cell cycle progression, DNA repair and cell migration (PubMed:23478445). Most substrates require their interaction with PCNA for their polyubiquitination: substrates interact with PCNA via their PIP-box, and those containing the 'K+4' motif in the PIP box, recruit the DCX(DTL) complex, leading to their degradation. In undamaged proliferating cells, the DCX(DTL) complex also promotes the 'Lys-164' monoubiquitination of PCNA, thereby being involved in PCNA-dependent translesion DNA synthesis (PubMed:20129063, PubMed:23478441, PubMed:23478445, PubMed:23677613). The DDB1-CUL4A-DTL E3 ligase complex regulates the circadian clock function by mediating the ubiquitination and degradation of CRY1 (PubMed:26431207).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR and lacks an exon in the coding region compared to variant 1. These differences result in the use of a alternate AUG, compared to variant 1. The encoded isoform (2) is shorter and has a distinct N-terminus compared isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...