Human CFTR activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	CFTR
Locus ID	1080
Kit Components	GA100776G1, CFTR gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: AGGAGGAGGAGGAGGAAGGC GA100776G2, CFTR gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTTTTCCCGATGATCCTAGT GA100776G3, CFTR gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: AAGGCAGGCTCCGGGGAAGC 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Disclaimer	These products are manufactured and supplied by OriGene under license from ERS. The kit is designed based on the best knowledge of CRISPRa SAM technology. The efficiency of the activation can be affected by many factors, including nucleosome occupancy status, chromatin structure and the gene expression level of the target, etc.
Reference Data
RefSeq	NM_000492
Synonyms	ABC35; ABCC7; CF; CFTR/MRP; dJ760C5.1; MRP7; TNR-CFTR
Summary	This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. The encoded protein functions as a chloride channel, making it unique among members of this protein family, and controls ion and water secretion and absorption in epithelial tissues. Channel activation is mediated by cycles of regulatory domain phosphorylation, ATP-binding by the nucleotide-binding domains, and ATP hydrolysis. Mutations in this gene cause cystic fibrosis, the most common lethal genetic disorder in populations of Northern European descent. The most frequently occurring mutation in cystic fibrosis, DeltaF508, results in impaired folding and trafficking of the encoded protein. Multiple pseudogenes have been identified in the human genome. [provided by RefSeq, Aug 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.