Sequencing Primer, V2-F

CAT#: GE100111

Forward primer to sequence targets cloned in expression vectors.



CNY 570.00


货期*
4周

规格
    • 1 nmol

Product images

Specifications

Product Data
sds_url /sds/ge100111.pdf
_pt 1
components 1 vial of lyophilized sequencing primer (1 nmol, sufficient for 100 sequencing reactions)
_c dna-sequencing-primer
sub_category DNA Sequencing Primers
availabilities_filter In Stock
description Forward primer to sequence targets cloned in expression vectors.
pdf_url /datasheet/ge100111.pdf
forward_seq 5' AGCAGAGCTCGTTTAGTGAACC 3'
storage Store at -20°C.
product_name Sequencing Primer, V2-F
vector PS100001, PS100002, PS100003, PS100004, PS100005, PS100006, PS100007, PS100008, PS100009, PS100010, PS100011, PS100012, PS100013, PS100014, PS100016, PS100017, PS100018, PS100020, PS100022, PS100024, PS100025, PS100026, PS100027, PS100034, PS100036, PS100038, PS100039, PS100040, PS100041, PS100042, PS100043, PS100044, PS100053, PS100054, PS100057, PS100058, PS100059, PS100064, PS100065, PS100066, PS100067, PS100069, PS100071, PS100074, PS100081, PS100082, PS100088, PS100092, PS100093, PS100094, PS100101, PS100102, PS100103, PS100104, PS100105, PS100107, PS100108, PS100109, PS100110, PS100111, PS100126, PS100135, PS100136, PS100139
category Gene Expression
stability The lyophilized and suspended primer is stable for one year from date of shipping when stored at -20°C
sizes_filter 1 nmol
quality_control The primer has been tested to generate satisfactory sequencing data on ABI 3730.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...