SOX9 Human qPCR Primer Pair (NM_000346)
CNY 1,140.00
Cited in 7 publications. |
Product images
CNY 2,710.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 6662 |
Forward Sequence | AGGAAGCTCGCGGACCAGTAC |
Reverse Sequence | GGTGGTCCTTCTTGTGCTGCAC |
Synonyms | CMD1; CMPD1; SRA1; SRXX2; SRXY10 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (7)
The use of this Gene Expression has been cited in the following citations: |
---|
Sonic hedgehog promotes chondrogenesis of rabbit bone marrow stem cells in a rotary cell culture system
,null,
BMC Developmental Biology
,PubMed ID 31401976
[SOX9]
|
A 3D chondrocyte-macrophage co-culture system to probe inflammation in experimental osteoarthritis
,Samavedi, S;Diaz-Rodriguez, P;Erndt-Marino, JD;Hahn, M;,
Tissue Eng Part A
,PubMed ID 27736317
[SOX9]
|
Evaluation of the osteoinductive capacity of polydopamine-coated poly (e-caprolactone) diacrylate shape memory foams
,Erndt-Marino, JD;Munoz-Pinto, DJ;,
ACS Biomaterials science and engineering
[SOX9]
|
SLUG is required for SOX9 stabilization and functions to promote cancer stem cells and metastasis in human lung carcinoma
,null,
Oncogene
,PubMed ID 26387547
[SOX9]
|
Development of 3D Alginate Encapsulation for Better ChondrogenicDifferentiation Potential than the 2D Pellet System
,Debnath, T;Shalini, U;Kona, LK;JVS, VS;Kamaraju, SR;,
J Stem Cell Res Ther
[SOX9]
|
In Vitro Osteogenic Potential of Human Mesenchymal Stem Cells Is Predicted by Runx2/Sox9 Ratio
,null,
Tissue Engineering. Part A
,PubMed ID 24980654
[SOX9]
|
Osteochondral Tissue Regeneration Through Polymeric Delivery of DNA Encoding for the SOX Trio and RUNX2
,null,
Acta biomaterialia
,PubMed ID 24854956
[SOX9]
|
Documents
FAQs |
Resources
基因表达相关资源 |