Osteopontin (SPP1) Human qPCR Primer Pair (NM_000582)
CNY 1,140.00
Cited in 7 publications. |
Product images
CNY 3,600.00
CNY 3,990.00
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Gene ID | 6696 |
Forward Sequence | CGAGGTGATAGTGTGGTTTATGG |
Reverse Sequence | GCACCATTCAACTCCTCGCTTTC |
Synonyms | BNSP; BSPI; ETA-1; OPN |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (7)
The use of this Gene Expression has been cited in the following citations: |
---|
Distinct Ring1b complexes defined by DEAD-box helicases and EMT transcription factors synergistically enhance E-cadherin silencing in breast cancer
,Wang, Y;Sun, Y;Shang, C;Chen, L;Chen, H;Wang, D;Zeng, X;,
Cell death & disease
,PubMed ID 33608512
[SPP1]
|
Alloimmune Responses of Humanized Mice to Human Pluripotent Stem Cell Therapeutics
,Kooreman, NG;de Almeida, PE;Stack, JP;Nelakanti, RV;Diecke, S;Shao, NY;Swijnenburg, RJ;Sanchez-Freire, V;Matsa, E;Liu, C;Connolly, AJ;Hamming, JF;Quax, PHA;Brehm, MA;Greiner, DL;Shultz, LD;Wu, JC;,
Cell Rep
,PubMed ID 28834758
[SPP1]
|
Probing the response of human osteoblasts following exposure to sympathetic neuron-like PC-12 cells in a 3D co-culture model
,Erndt-Marino, J;Hahn, MS;,
J Biomed Mater Res A
,PubMed ID 27860234
[SPP1]
|
Osteoinductive PolyHIPE Foams as Injectable Bone Grafts
,Robinson, J;McEnery, M;Pearce, H;Whitely, M;Munoz-Pinto, D;Hahn, M;Li, H;Sears, N;Cosgriff-Hernandez, E;,
Tissue Eng Part A
,PubMed ID 26739120
[SPP1]
|
Evaluation of the osteoinductive capacity of polydopamine-coated poly (e-caprolactone) diacrylate shape memory foams
,Erndt-Marino, JD;Munoz-Pinto, DJ;,
ACS Biomaterials science and engineering
[SPP1]
|
A bioactive “self-fitting” shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
,Zhang, D;George, OJ;Petersen, KM;,
Acta biomaterialia July 2014
[SPP1]
|
A bioactive self-fitting shape memory polymer (SMP) scaffold with potential to treat cranio-maxillofacial (CMF) bone defects
,Zhang, D;George, OJ;Petersen, KM;Jimenez-Vergara, AC;Hahn, MS;Grunlan, MA;,
Acta Biomater July 2014
,PubMed ID 25063999
[SPP1]
|
Documents
FAQs |
Resources
基因表达相关资源 |