TRPA1 Human qPCR Primer Pair (NM_007332)
CNY 1,140.00
Cited in 7 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 2,710.00
CNY 17,440.00
CNY 11,688.00
Specifications
Product Data | |
Gene ID | 8989 |
Forward Sequence | TCCTCTCCATCTGGCAGCAAAG |
Reverse Sequence | GGACGCATGATGCAAAGCTGTC |
Synonyms | ANKTM1; FEPS; FEPS1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (7)
The use of this Gene Expression has been cited in the following citations: |
---|
Oxidative stress mediates thalidomide-induced pain by targeting peripheral TRPA1 and central TRPV4
,null,
BMC Biology
,PubMed ID 33317522
[TRPA1]
|
Photoactivatable Odorants for Chemosensory Research.
,null,
ACS chemical biology
,PubMed ID 32865973
[TRPA1]
|
Human TRPA1 activation by terpenes derived from the essential oil of daidai, Citrus aurantium L. var. daidai Makino.
,null,
Bioscience, biotechnology, and biochemistry
,PubMed ID 31072263
[TRPA1]
|
TRPA1–FGFR2 binding event is a regulatory oncogenic driver modulated by miRNA-142-3p
,null,
Nature Communications
,PubMed ID 29038531
[TRPA1]
|
Analgesic effect of dimethyl trisulfide in mice is mediated by TRPA1 and sst4 receptors.
,null,
Nitric oxide : biology and chemistry
,PubMed ID 28137611
[TRPA1]
|
The First Extracellular Linker Is Important for Several Aspects of the Gating Mechanism of Human TRPA1 Channel
,null,
Frontiers in Molecular Neuroscience
,PubMed ID 28197074
[TRPA1]
|
Activation and Inhibition of Thermosensitive TRP Channels by Voacangine, an Alkaloid Present in Voacanga africana, an African Tree
,Terada, Y;Horie, S;Takayama, H;Uchida, K;Tominaga, M;Watanabe, T;,
J. Nat. Prod., Feb 2014.
,PubMed ID 24484240
[TRPA1]
|
Documents
FAQs |
Resources
基因表达相关资源 |