PD-L1 (CD274) Human qPCR Primer Pair (NM_014143)
CNY 1,140.00
Cited in 3 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
CNY 2,400.00
CNY 3,990.00
CNY 2,710.00
CNY 3,600.00
CNY 4,180.00
Specifications
Product Data | |
Gene ID | 29126 |
Forward Sequence | TGCCGACTACAAGCGAATTACTG |
Reverse Sequence | CTGCTTGTCCAGATGACTTCGG |
Synonyms | B7-H; B7H1; hPD-L1; PD-L1; PDCD1L1; PDCD1LG1; PDL1 |
Quality Control | The primer mix has been tested to generate satisfactory qPCR data on ABI 7900HT by using the following PCR program: Stage 1: Activation: 50 °C for 2 min; Stage 2: pre-soak:95 °C for 10 min; Stage 3: Denaturation: 95 °C for 15 sec, Annealing: 60°C for 1 min; Stage 4: Melting curve: 95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec. |
Storage & Stability | Store at -20°C. |
Citations (3)
The use of this Gene Expression has been cited in the following citations: |
---|
Stimulierende und inhibierende Signalwege der APZ- und T-Zell-Interaktion sowie Einfluss von TLR-Agonisten auf APZ
,null,
HNO
,PubMed ID 33128107
[CD274]
|
HDAC6 plays a non-canonical role in the regulation of anti-tumor immune responses, dissemination, and invasiveness of breast cancer
,Banik, D;Noonepalle, S;Hadley, M;Palmer, E;Gracia-Hernandez, M;Zevallos-Delgado, C;Manhas, N;Simonyan, H;Young, CN;Popratiloff, A;Chiappinelli, KB;Fernandes, R;Sotomayor, EM;Villagra, A;,
Cancer Res.
,PubMed ID 32605998
[CD274]
|
Gene Signatures of 1,25-Dihydroxyvitamin D3 Exposure in Normal and Transformed Mammary Cells
,Simmons, KM;Beaudin, SG;Narvaez, CJ;Welsh, J;,
J. Cell. Biochem.
,PubMed ID 25736056
[CD274]
|
Documents
FAQs |
Resources
基因表达相关资源 |